KEGG   Burkholderia multivorans ATCC 17616 (Tohoku): BMULJ_04841Help
Entry
BMULJ_04841       gene      T00740                                 

Gene name
glsA
Definition
(GenBank) glsA
Organism
bmj  Burkholderia multivorans ATCC 17616 (Tohoku)
SSDB OrthologParalogGene clusterGFIT
Position
2:1851996..1852910
Genome map
NT seq 915 nt NT seq  +upstreamnt  +downstreamnt
atgaactaccaaccgattctcgaacgcatccataccgaactcgccccctggatcggccag
ggccgcgtggccgactacattcccgagctcgcgaaagtacccgccgacaagttcgggatg
gcggtcgtcacgctcgacggcaacgtttacacggtcggcgacgcgcaggagcgcttctcg
atccagagcatctcgaagctgttcgcgtgcacgctcgcgttccagctgctcggcgacgcg
ctgtgggaacgcgtcggccgcgaaccgtccggcaccgcgttcaattcgctcgtgcagctc
gaaagcgagcgcggcaagccgcgcaatccgttcatcaacgcgggcgcgctcgtcgtcacc
gacgtgctgtgccgccgcttcgtgaaggcggaaaccgcgctcgtcgaattcgtgcggcga
ctgatcggcgcgaacgacatcgactacgattcgcgcgtcgcgctgtcggagctgcagcac
gcggagcgcaatcgcgcgatggcgcatttcatggcgagcttcggcaacatgcagatgccg
ccggaaacggtcgtcgatgcgtattgccgtcagtgcgcgatcacgatgaactgcgtcgag
ctcgcgcgcgccgcgttgtttcttgcgaacgggggtgtggcgcctgcgaccggggagagg
atcgtcgatccgagttcggcgaaacggctgtcggcgctgatgctgacctgcggcacttat
gacgcggccggggatttcgtctatcgcgtcgggctgccggcgaagagcggcgtcggcggc
gggatcgttgcggtgctgcccggcgagatggcggtctgcgtgtgggcgccggggctcgat
gcgaacgggaattcgttggcagggacgttggcgttggagtggttgacgacttattcggga
aggtcgattttttga

DBGET integrated database retrieval system