KEGG   Burkholderia multivorans ATCC 17616 (Tohoku): BMULJ_04978Help
Entry
BMULJ_04978       gene      T00740                                 

Gene name
fdhA2
Definition
(GenBank) fdhA2
Organism
bmj  Burkholderia multivorans ATCC 17616 (Tohoku)
SSDB OrthologParalogGene clusterGFIT
Position
2:complement(2002924..2004120)
Genome map
NT seq 1197 nt NT seq  +upstreamnt  +downstreamnt
atgagcagcaatcgaggtgtcgtctatcttgggccgggcaaggtcgaggtgcagaagatc
gattatccgaagatggtcgacccgagcggccgcgcaatcggacacggcgtgatcctgaag
gtcgtcagcacgaacatctgcggctcggaccagcacatggtgcgcggccgcacgacggcg
ccggtcggtctcgtgctcggtcacgagatcacgggcgaggtcgtcgaggtcggtcgcgac
gtcgagacgctgaagatcggcgatctcgtgtcggtgccgttcaacgtcgcgtgcggccgc
tgcgcgatgtgcaaggaaacgcatacgggcgtgtgcctgaacgtgaacccgtcgcgcgcg
ggcggcgcgtacggctacgtcgacatgggcggctggatcggcggccaggccgaatacgtg
ctcgtgccgtatgccgacttcaacctgctgaaattcccggaccgcgatcaggcgatggcg
aagatccgcgatctgacctgcctgtccgacattctgccgaccggttatcacggcgcggtc
agcgccggcgtgaagccgggctcgaccgtctacatcgcgggcgcgggcccggtcgggatg
gcggcggccgcctcggcgcgcctgctcggcgcggccgtgacgatcgtcggcgacatgaac
gcggaacgcctcgcgcatgcgaaggcgatgggcttcgagacggtcgacctgtcgaaggac
gcgacgctcggcgaacagatcgcgcagatcctcggcaagccggagatcgactgcgcggtc
gactgcgtcggcttcgaggcgcacggccacggctcgtcgggccatgcggaagaagcgccc
gcgacggtgctgaactcgctgatggaaatcacgcggccggccggtgcgatcggcattccg
ggcctgtacgtgacggacgatccgggcgcgcaggacaaggccgcgcagcacggcagcctg
agcatccgcttcggtctcggctgggcgaagtcacattcgttcttcacgggccagacgccg
gtgctgaagtacaaccgcaacctgatgcaggcgatcctgtacgaccgcctgccgatcgcg
aagatcgtcaacgtgacggtgatctcgctcgacgacgcgcccgaaggctacaagaagttc
gacggcggcgcgccgcgcaaattcgtgatcgatccgcacgggctgctcgcggcctga

DBGET integrated database retrieval system