KEGG   Burkholderia multivorans ATCC 17616 (Tohoku): BMULJ_05080Help
Entry
BMULJ_05080       gene      T00740                                 

Gene name
speB
Definition
(GenBank) speB
Organism
bmj  Burkholderia multivorans ATCC 17616 (Tohoku)
SSDB OrthologParalogGene clusterGFIT
Position
2:2135775..2136731
Genome map
NT seq 957 nt NT seq  +upstreamnt  +downstreamnt
atgaacgaccacacccatttccagccgctcggcggcaatgaaatgccgcgctgcggcggc
atcgcgacgatgatgcgcctgccgcacgtggcgagcgccgccggcctcgacgcctgcttc
gtcggcgtgccgttcgatctcggcacgtcgaaccgcaccggcgcacgcttcggcccgcgc
cagatccgtaccgaatccgtgctgctgcgcccgtacaacatggcgacgcgcgccgcgccg
ttcgattcgctgcagatcgccgacatcggcgacgtcgcgatcaatccgtacaacctgcac
gattcgatcgcgcgcatcgaagccgcgtacgacgcgatcctcgagcacgactgcaagccg
atcacgctcggcggcgatcatacgatcgcgctgccgatcctgcgcgcgatccaccgcaag
cacggcaaggtcgcattgatccacgtcgatgcgcacgccgacgtgaacgatacgatgatg
ggcgaaaagatcgcgcacggcacgccgtttcgccgcgcggtcgaggaaggcctgctgcac
ggcgacaaggtcacgcagatcggcctgcgcggcaccggctacgcagccgaagacttcgac
tggtgccgcgagcagggtttccgcgtcgttcaggcggaagaatgctggaacaagtcgctc
gcgccgctgatggacgaagtgcgcgagcgtgtcggcgacacgcccgtctacatcagcttc
gacatcgacggcatcgatcccgcctacgcaccgggcaccggcacgcccgaaatcgcgggc
ctcacggtgccgcaggcgctcgagatcatccgcggcgcgcgcgggctgaacatcgtcggc
tgcgatctcgtcgaagtcgcgccgccgtacgacccgttcggcacgacggcactgctcggc
gcgaacctcgcatacgagctgctgtgcgtgctgccgggcgtcgcgtaccgcgactga

DBGET integrated database retrieval system