KEGG   Burkholderia multivorans ATCC 17616 (Tohoku): BMULJ_05269Help
Entry
BMULJ_05269       gene      T00740                                 

Definition
(GenBank) BMULJ_05269
Organism
bmj  Burkholderia multivorans ATCC 17616 (Tohoku)
SSDB OrthologParalogGene clusterGFIT
Position
2:2344549..2345556
Genome map
NT seq 1008 nt NT seq  +upstreamnt  +downstreamnt
atgactgatacctcccgcgatctcgttctcgtcaccggcgcgtccggtttcgtcggctcg
gctgtcgcgcgcatcgcgcagcagaaaggctatgcggtgcgtgtgctggtgcgcccgacg
agcccgcgcacgaacgtcgccgatctcgacgccgagatcgtcaccggcgacatgcgcgac
gagacgtcgatgcgcgccgcgctgcgcggcgtgcgctacctgctgcacgtcgcggccgac
taccggctgtgggcgccggacccgcacgagatcgaacgcgcgaacctcgaaggcgccgtc
gcgacgatgcgcgccgcgcgcgccgaaggcgtcgagcggatcgtctatacgagcagcgtc
gcgacgctgaaggtcacgagcgccggcgatccggccgacgagaaccggccgctcacgccc
gagcaggcgatcggcgtgtacaagcgcagcaaggtgctcgccgagcgtgcggtcgagcgg
atgatcgccgacgaagggctgcccgcggtgatcgtcaacccgtcgacgccgatcggcccg
cgcgacgtgaagccgacgccgaccggccgcatcatcgtcgaggccgcgctcggcaagatt
ccggcgttcgtcgatacggggctgaacctcgtgcatgtcgacgacgtcgcgcacggccac
ttcctcgcgctcgagcgcggccggatcggcgagcgctacatcctgggcggcgagaacctg
ccgctgcagcagatgctcgccgacatcgcgcagatgacgggccgcaaggcgccgacgatc
gcgctgccgcgctggccgttgtacccgctcgcggtcggcgccgaggcggtcgcgaagttc
acgaagaaggagccgttcgtcacggtcgacgggctgcggatgtcgaagaacaagatgtat
ttcacgtccgcgaaggccgagcgcgaactcggctaccgcgcgcggccgtaccgcgacggg
ctgcgcgacgcgctcgactggttccgcggcgcgggctacctgaagtag

DBGET integrated database retrieval system