KEGG   Burkholderia multivorans ATCC 17616 (Tohoku): BMULJ_05332Help
Entry
BMULJ_05332       gene      T00740                                 

Gene name
cheR
Definition
(GenBank) cheR
Organism
bmj  Burkholderia multivorans ATCC 17616 (Tohoku)
SSDB OrthologParalogGene clusterGFIT
Position
2:2416868..2421010
Genome map
NT seq 4143 nt NT seq  +upstreamnt  +downstreamnt
atggcacggcaagagcctaccgatcgggagcggcttcccgcgtctgcgacgttgcgaagc
gatctgacgtttccgatcgtgggcatcggcgcatcggcaggcggcacgacggccttgcag
accttcttcgagaacgcgccgaccggcatggaaatggcgttcgtcgtcatcgtccatctg
gccccggagcagatcagccacatggacagcgtgctgcagcacacgaccggcatgccggtc
cgtcaggtgacgagcaccgtcccgatcgaaaagaaccatatctacgtgatcgcgcccggc
atgcagctcgaaatggcggacggctgcctgcgttgcagcccgcgcgagatgtcgggcggc
gtcgcgctgacgatcgaccactttttccggacgctggccgacgcgcacgattcgcgcgcg
atcggcatcgtgatgtccgggacgggctccgacggcgcggcggggctgcgccgcatcaag
gaagtcggcggcatcacgctcgcgcagacgcccgacgatgccgaacacgccgagatgccg
aagcaggcgattgcggtcggcggcgccgatatcgtgctgcccgccgccgaaatgccgcaa
cggctgctcgatctctgggccaacgcgcggcgcatcgaacaacaagggctcgaactcgcg
cacgcccatcagaatctcgaccggccgggtgccaacgaccccgaacgcgcgctgtcggac
atcctgatgcatttgcgcgtgcgcaccgggcacgacttccggctctacaagcgcgcgacc
gtgctgcgccggatcgaacggcgcatgcaggtcaacgggcagcgcgacctgctcgcgtac
cgcgatttcctgcgcgcgacacccgacgaggcgaacgcgctgctcgccgacatgctgatc
ggcgtcacgcagttcttccgcgatcgcgacgcgttcgacttcctcgaacgcgaggtgatc
gcgtcgatgttctcgccggatgccggcgaggaacaggtgcgcgtctgggtcgccggctgc
gcgacgggcgaggaggcgtattcgatctcgctgctgctcgcccgtgcgcgcgagacggcc
gtgtcgagccaggcgatccaggtgttcgcgaccgacatcgacgaagcggcgatcgtgcgc
gcgcgcaccggctcctatccgctgtcgatcgcagccgacgtgcccgaaccgctgctgcag
cggtatttcacgcgcgacggcgcgcatttcgtgattgcgaaatcggtgcgcgagcgcatt
ctgttcgccgcgcacagcctgctgcgcgatccgccgttctcgcatctcgatctgatctcg
tgccgcaacgtgctgatctacctcgaacgcgcggtgcagcggcagatcctcgagctgttt
cacttcgcgctgcgcccgaacggctatctgttcctcggcaccgccgaatcggccgacgcg
gccgacgatctgtttaccgtcgtcgacaagaagcgccgcatctatcaggcgcgcgtcgtc
acgcatcgcgcgaaaacgccgaccggttgcccgccgctgctgcacgtcgaatcgggttcg
gccgacgagcggcccgtgccgacgccggcgctgcgtgcgccggcgagcccggtccagcgc
aatttctcgtatgcggaactccatcaacgggcactggaaatgtattcgccgccgagcgtg
atcatcgacaaggaatcgaacgtcgtgcatctgtcggacaacgccggccgattcctgcgc
cacgtcggcggcgagctgtcgagcaacatcatgacgctcgtgctgcccgacctgcggctc
gacctgcgcaccgccatcttccgcgcgctgcagacgggcacgagcgtcgaggcgcgccgc
gtcaagtggacgcacgacacgcaggtgtcgtggatcaacatgacggtgcggccgtttcac
gacaaggttgcgaacgcggactttctgctcgtcgtgttcgacgaggtggccgggcgcatg
accgacgaggaccaggccgaagccaccgggcaggatccggtgctcgcgcagctcgagcac
gaactgcagcacagccgcgagcagctcgcgacgatcatcgagcagtatgaaacctcggtc
gaggaactgaaggcctcgaacgaggaactgcaggcgatcaacgaggagctgcgctcgacc
agcgaggagctcgaaagcagcaaggaagaactgcagtcggtgaacgaggagctgacgacc
gcgaacgccgagatgcaggcgcggatcgaggacaccgccaaggccaacgacgatctgcac
aacatcatcgcctcgagcgagatcgcgaccgtcttcgtcgacaaggaaatccgcatcaag
cgcttcacgccgaacgcgaccgcgatcttcaacctgatcgacagcgatctcggccgctcg
ctgtttcacatcacccattcgctgcgctatccgacgctcgccgacgacgtgcggcagtcg
ttccagtcgctgcggctgatcgaacgcgagatcgagagcgaggccgggcgctggtatctg
atccggttgctgccgtatcgcaccgccgacgaccatatcgacggcgccgtcatcacgctg
atcgacgtcacggatcgccatcacgcggaggaagccgcgcgggccggcgagcagcggctg
cgcctcgtcgcgcagtcgacgaaggactacgcgatcatcatccaggacggcaacggcatc
atcgcgagctggaatgcgggggccgaacggatcttcggctataccgaagacgaaatgatc
ggccaggacgtcgagctgatctacgagccgaacgaccggcatgcgcgcgtgccggcgcac
gagcgcgaggtcgcggcgcgcgaaggccgcgcggacgacgaacgctggcatcgcacgaag
gacgggcggcggatcttctgcagcggtgtcgtgacgccgattgccgatacgtcgttcaac
ggcttcgcgaagatcgtccgcgacctgacgcagcgcaagctcagcgaggacgcgaaccgc
gaagcgctcgcgcgcgagcaggccgcccgcgagcaggcgctcagttccaatcagctgaag
gacgagttcatcgccgtgctgtcgcacgaattgcggcatccgctgaacctgatcggcgtg
cgtgccgaaatgctgccgcgtctgcccgaaacgcgcgacatccccgcggtgcgcgaagcg
gccgagctgattcggcaggcggtacgcgcgcaggcgcagatcatcgacgatctgctcgat
ctgtcccgcatccgcaccggcaagctcgcgctcgagctgtcgcgcgtcgatctgacggcg
gtgctgcgcacgatcgtcgatacgtgcgaggcggacgcgcacgcgcgcggcctcgtgctg
accgccgagttgccggacgagccggcgattgcgctcgccgatccgatccgctgcgagcag
attttctggaacctgatgtcgaatgcgctgaagttcacgcatgcaggcggccggatcgtc
gtgcggctcacgcatgaagcgcggatgctgcgcgtcgacgtgatcgacgacggacaggga
atcgaccgcgacacgcttccgcacgtgttcgacatgttccgccaggcgccgcgcgaccgc
acgcgcggcgggctcggcatcgggctcgcgctcgtgcggcagctcgtcgaaatgcacgac
ggccgcatttcggcggcgtccgaggggcccgggcgcggcaccacgatgacggtgtggctg
ccggccgccgccgacacgcgcgtcgcggccgccgaccgccgcgcgtcggagggccgtatc
gcgggcctgcacgtgctgctcgtcgaggacgacgccgagaccgcgctgtcgctgactacc
ctgctgaaactggcgggcgcggaggtgcgcaccgcggcgagcggcgcagcggcgctggag
atgctcgcgcaaggccccgtcgatgcgatcgtgtccgatatcgggctgcccgacatggac
ggttacgcgctgctgcgccgaatcaaggccgatccgcaatgggcgcaggtgaaggcgatc
gcgctgacgggccgtaaccgtcagaccgacgtcggcgccgcgacccaagccggattcgac
acgcatctgccgaaaccgctcgatttcggcttgttgctcgcggccctcgccgaaccgcgc
tga

DBGET integrated database retrieval system