KEGG   Burkholderia multivorans ATCC 17616 (Tohoku): BMULJ_05336Help
Entry
BMULJ_05336       gene      T00740                                 

Gene name
glcB
Definition
(GenBank) glcB
Organism
bmj  Burkholderia multivorans ATCC 17616 (Tohoku)
SSDB OrthologParalogGene clusterGFIT
Position
2:2424685..2426859
Genome map
NT seq 2175 nt NT seq  +upstreamnt  +downstreamnt
atgatcgaccatgacggactgcaagtcgcgccagcgctgagccagttcatcgaaaacgaa
gcgctgccgggcaccggcatcgaccaagccgcgttctggcgcggcttctccgcactggtg
cacgaccttgcgccgcgcaaccgcgaactgctcgccgagcgcgaccgtctgcaaagcgaa
ctcgacgcctggcatcgcgcgcaccccggcccggtgcgcgacctcgccgcgtatcgcgcg
ttcctcgagcagatcggctacctggtgccgacgccggccgacgtcgcggccacgaccgcg
aacgtcgacagcgaaatcgcgacgcaggccggcccgcagctcgtcgtgccgctgtcgaac
gcgcgctatgcgctgaacgcggcgaacgcgcgctggggcagcctgtacgacgcgctgtac
ggcaccgacgcgctgccggaagacaacggcgccgagcgcaccgcaacgtacaacccgacg
cgcggccagcgcgtgatcgactacgcgcgcaacgtgctcgacaacgcggcgccgctggcc
ggtgcgtcgcaccgcgacgcgctgcgctaccgcgtgcaggacggccagctcgccgtcgag
accggcaagggcatcgtgcacctcgcgcagcccgcgcaattcgtcggctaccagggcgcg
gccgatgcgccctccgcgatcctgctgaagcacaacgggctccatctcgagatccagatc
gacggctcgacgccgatcggccgcgcggacgtcgcgaacgtgaaggacgtcgtgctcgaa
gcggcggtcagcacgatcatcgactgcgaggattcggtcgcggccgtcgacgccgaggac
aaggtgcagctgtaccgcaactggctcgggctgatgcagggcacgctggtggaggaagtg
tcgaagggcggcaagacgttcacgcgccgcctgaacgcggaccgcgaatacacgacgccc
gacggcggcacgctgacgctgcacggccgctcgctgctgttcgtgcgcaacgtcgggcac
ctgatgacgatcggcgcggtgctcgatcgcgacggcaacgagattccggaaggcatcctc
gatggcgtcgtcacgacactctgcgcgctgcacgacctgaagtcgaagcgcaattcgcgc
accggctccatctacatcgtgaagccgaagatgcacggcccggccgaagtcgcgttcgcc
gatacgctattcgcgcgcatcgaggatctctacgggctgccgcgcaatacgctgaagatg
ggcatcatggacgaggagcgccgcaccagcgtgaacctcgccgcctgcatcgcggccgcc
gccgcgcgcgtcgcattcatcaacacgggcttcctcgatcgcaccggcgacgagatgcac
agcgcgatggaagcgggaccgatgatccgcaagggcgacatgaagtcgtccgcatggatc
gccgcgtacgagcgcaacaacgtgctcgccgggctgtcggccggactgcgtgggcgcgcg
cagatcggcaaggggatgtgggcgatgcccgacctgatgcacgcgatgctcgagcagaag
atcgcgcatccgcgcgcgggcgcgaacaccgcgtgggtgccctcgccgaccgccgcgacg
ctgcatgcgctgcactaccatctcgtcgacgtgcaggccgtccagcaggaactcgaaagg
acgccgtacgcgagcgagcgcgacgcgctgctcgacgggctgctgaccgtgccggtcgtc
gagcgtgccgcgtggagcgacgaagagatcctgcgcgaagtcgaaaacaacgcgcagggc
attctcggctacgtcgtgcggtgggtcgaacagggcgtcggctgctcgaaggtgccggac
atccacgacgtcggcctgatggaagaccgcgcgacgctgcgcatctcgagccagcacatc
gcgaactggctgcgtcacggcgtgatcaccgaggcgttcgtgctcgacgtgttcaagcgg
atggcgcgcgtcgtcgaccagcagaacgcgggcgacccgaactatcgtccgatggcgccc
gactacgaccggtcggtcgcgttccaggctgcctgcgcgctcgcgctgcacggcacgtcg
cagccgagcggctatacggagccgctgctgcaccggttccggcttgcgttcaaggcgcag
caggcacaggcctaa

DBGET integrated database retrieval system