KEGG   Burkholderia mallei NCTC 10229: BMA10229_1081Help
Entry
BMA10229_1081     gene      T00471                                 

Definition
(GenBank) pseudogene
Organism
bml  Burkholderia mallei NCTC 10229
SSDB OrthologParalogGene clusterGFIT
Position
II:1135448..1136343
Genome map
NT seq 896 nt NT seq  +upstreamnt  +downstreamnt
ttgaatcgctacgccttctttctcatcgcgtcgatgttgctcgtcggcagcaacgtcggc
atcggcaaatcgatcgtcgccttcgttcccgtcgtcatcctcgccacgctgcgcttcgtc
atcgcgaacgcggtgctctggccgctcttcagccccgtgaagatgcgcgccgtcaagcgc
ggcgaatggctgaacctgttcctgcaggcgttcttcggcacgttcatgttcacgctgctg
atgctcaacggcgtgcagcgcacgagcgccgtcgcggcgggcgtcatcacgagcacgatt
cccgccgtcgtcgcgctgttcgcatggctcttcctgcgcgagaagccgaacgggcgtgcg
ctcgtatcgatcgcgctcgcgatcgtcggcgtcgtgacgatcaatgtcgcgaacggcacc
gcgagcgaaggcggcgcgcacgcgagctcgccggcaatctgctgatgctcggcgcggtct
gctgcgagtcgatctacgtgatcctgtcgcggcgcctcacgcagacgctcgcgccgatcg
acatctgcgcgtacacccatctgttcggcctgctgctgatgctgccgctcggcgcgggcg
cgctctggcatttcgactacgcgagcgtgccggcgggcatctgggcgctcgtcgtctggt
acggcgtgtccgcgagcatcttctcgttctggctgtggatgaaaggcatccgccacgtgc
cgggcagcctcgccggcgtgttcagcgcggtgctgccgatcgcggccgcgatctacggca
tcctgttcctcggcgagcggccgacgctcgcgcacggcttcgcgctcgcgtgcgtcgtga
cgggcatcgtgctcgcgagcctgcgcgtgcggcgcgccccgcccgtttcaccgtga

DBGET integrated database retrieval system