KEGG   Burkholderia mallei NCTC 10229: BMA10229_1996Help
Entry
BMA10229_1996     CDS       T00471                                 

Definition
(GenBank) hypothetical protein
Organism
bml  Burkholderia mallei NCTC 10229
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: 
UniProt: 
Position
II:2054528..2054725
Genome map
AA seq 65 aa AA seqDB search
MTRDARCAMRDARCAMRARPPAPGIGRDARGDARGIRTVFFRANPAGCRGRIPASNRHEF
RMNAG
NT seq 198 nt NT seq  +upstreamnt  +downstreamnt
gtgacgcgcgatgcgcgatgcgcgatgcgcgatgcgcgatgcgcgatgcgcgcgcgcccg
ccggcgccgggcatcggacgagatgcgcggggcgatgcgcgcggcatccgcacggttttc
tttcgtgcgaatccggcaggatgccgcggccggattccggcatcgaatcggcatgaattc
cgcatgaatgccggatga

DBGET integrated database retrieval system