KEGG   Burkholderia mallei NCTC 10229: BMA10229_A0535Help
Entry
BMA10229_A0535    gene      T00471                                 

Gene name
glgB
Definition
(GenBank) pseudogene
Organism
bml  Burkholderia mallei NCTC 10229
SSDB OrthologParalogGene clusterGFIT
Position
I:556509..558721
Genome map
NT seq 2213 nt NT seq  +upstreamnt  +downstreamnt
atgacggatgcgcccttcgatcgcgccgacatcgacgcgctcctcgacgcgcgccatccg
gacccgttcgcgtgcctcggcccgcaccgcgtcggcgacgcgacggtcgtgcgcacgctg
ctgcccggcgcgctgcgggttcgcgcgatcgcggcgggcggcggcgtgctcggcgagctg
cggcaggtcgatccggccggctgcttcgccggcgcgctgcccgatgggcaggaacgcggc
gagcagccgcgctatcggctgtcgatcgactggcccgacgcgcgacaggacgtggaggac
gcgtatgcgttcggcacgctgctcgacgaggatgcgctcgcgcgcttcgcggcgggcgat
ccgcgcgcggcgctcgcgtgcctcggcgcgcgcgcgctcgacatggatggcgtgcccggc
gtgcggttcgccgtctgggcgccgggcgcgtcgcgcgtgtcggtggtcggcgatttcaac
ggctgggatgcgcgccgccacccgatgcggctgcgccgcccgtggggcgtgtgggagctg
ttcgtgccgcgcatcggcgcgggcgagcgctacaagttcgcgctgcgcgcgcgcgacggc
gccgcgctgccgctgaaggccgacccgtgcgcgtgccgcaccgaggcgccgccgcgcacc
gcgtcgatcgtcgccgatctcgacgcgctcgagcgcttcggctggcacgacgacgcgtgg
ctgcgcgcgcgtcgctcgatctcgcgcacgcgccggtgtcgatctacgaagtccatccgg
aatcgtggctgcgcgtcgcggccgagggcaatcgcagcgcgacgtgggacgagctcgcgc
agcggctgattccgtatgcggccggcatgggcttctcgcacgtcgagctcacgccgatcg
ccgagtatccgttcggcggctcgtggggctaccagtcgctgtcgccgttcgcgccgtccg
cgcggttcgggccgccggaaggcttcgcgcgcttcgtcgagcacgcgcacgcggccggcc
tcggcgtgatcgtcgactgggtgcccgcgcactttcccgacgatccgcacgggctcggca
aattcgacggcaccgcgctgttcgagcatgcggacccgcgcgagggatggcatccggact
ggcacacgcacgtgttcaacgtcgggcggcgcgaagtcggcgcgttcctgatcgcgtcgg
cgctcgcgtgggcgcaccgctatcacgtcgacggcattcgcgtcgacgccgtcgcgtcga
tgctctaccgcgactactcgcgcgcggcgggcgaatgggtgccgaacgtgtacggcgggc
gcgagaacctcgaatcgatcgcgttcctgaagcacttcaacgacacgctgcacgggcccg
ccgcgccgcccggcgtcgcgacgttcgcggaggaatcgaccgcatggcccggcgtcaccg
cgccgaccgccgagcacggcctcggcttcgatttcaagtggaacatgggctggatgcacg
acacgctcgcctatctgcgcgaggacccgatccatcgccgccatcaccacgaccgactca
cgttcgggctcgtctatgcgttctccgagcgcttcgtgctgccgctgtcgcacgacgaag
tcgtgcacggcaagggctcgctcgcggccaagatgccgggcgacgcctggcagcgcctcg
cgaacctgcgcgcgtacttcggcttcatgtgggcgcatccgggcaagaagctgctgttca
tgggcggcgagttcgcgcagtggggggagttcgcgcacgacgcgacgccgcagtgggatc
tgctcgacgcgcccgcgcaccggggcgtgcagcgcctcgtgcgcgacctgaaccggctgc
atgcggccgagccggcgctgcacgcgctcgacgaccggcccgccgggttcgcgtggctcg
tcggcgacgatcgcaacaacagcgtgttcgcgttcgtccgtcgcgacgatgcgggccgca
tgctcgtcgcggtgtgcaacttcacgccggtgccgcgcaccgactatcggctcggcctgc
ccgcgccgggccgctgggccgaggtgctgaacaccgacggcgccgcatacggcggcaccg
acgcgggcaacggcggcgcggtccaggccgacgagattcccgcgcacggcgagcgatggt
cggccgcgctgcgcctgccgccgctcgcgacgctatggctgcgccccgcctga

DBGET integrated database retrieval system