KEGG   Brucella melitensis M28: BM28_B0268Help
Entry
BM28_B0268        CDS       T01852                                 

Definition
(RefSeq) nitrous-oxide reductase
  KO
K00376  
nitrous-oxide reductase [EC:1.7.2.4]
Organism
bmz  Brucella melitensis M28
Pathway
Nitrogen metabolism
Microbial metabolism in diverse environments
Module
Denitrification, nitrate => nitrogen
Brite
KEGG Orthology (KO) [BR:bmz00001]
 Metabolism
  Energy metabolism
   00910 Nitrogen metabolism
    BM28_B0268
Enzymes [BR:bmz01000]
 1. Oxidoreductases
  1.7  Acting on other nitrogenous compounds as donors
   1.7.2  With a cytochrome as acceptor
    1.7.2.4  nitrous-oxide reductase
     BM28_B0268
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: 
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
2:257869..258627
Genome map
AA seq 252 aa AA seqDB search
MTEETRKSQLSRRQLLGTSAFVAAAGASGLGGALLAGSSETALAAGAAKGGMSPEVKPGE
LDEYYVFFSSGQCGEVRIVGLPSMRELMRIPVFNRDSATGWGLTNESRKVLTEGLLPQDR
EFLKDRGDIFLNGDLHHPHPSFTDGTYDGRYLYANDKANTRVCRIRLDVMKCDKIIQLPN
QHTVHGLRVQKYPKTGYVFCNGEDRVPIPNDGSHLNDVKQYHAIFTAVDGETMKVAWQVM
VDGNLDNVDCDY
NT seq 759 nt NT seq  +upstreamnt  +downstreamnt
atgactgaagaaaccaggaaatcgcagctcagtcgaagacaattgctcggaacttcggca
tttgtcgcggcagccggtgcaagcgggctcggcggggctctgcttgccggttccagcgaa
actgcgcttgcggctggcgccgcaaagggcggcatgagccccgaagtcaagccgggggaa
ctggacgaatattacgtcttcttctccagcggccagtgtggtgaagtgcgtattgtcggc
ctgccgtcgatgcgtgagctgatgcgcatcccggtcttcaaccgtgacagcgccaccggt
tggggcctgacgaatgaaagccgcaaagtgttgacggaaggcctgcttccgcaggaccgt
gaattcctcaaggatcgcggcgacatcttcctcaatggcgacctgcaccacccgcatccc
tctttcaccgatggaacctatgacggtcgttatctttatgccaacgacaaggccaatacg
cgcgtctgccgtatccgcctcgacgtgatgaagtgcgacaagatcattcagttgccgaac
cagcatacggttcacggcctgcgtgtgcagaaatatccgaagaccggctatgtcttctgt
aatggcgaagaccgtgtaccgatcccgaatgatggcagccacctgaatgacgtcaagcag
taccatgccatcttcaccgccgttgacggtgaaacgatgaaggtcgcctggcaggtgatg
gtcgatggcaatctcgacaatgtggattgcgactattag

DBGET integrated database retrieval system