KEGG   Bifidobacterium animalis subsp. lactis CNCM I-2494: BALAC2494_00624Help
Entry
BALAC2494_00624   CDS       T01842                                 

Definition
2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase (EC:2.7.6.3 4.1.2.25)
Orthology
K13940  
dihydroneopterin aldolase / 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase [EC:4.1.2.25 2.7.6.3]
Organism
bnm  Bifidobacterium animalis subsp. lactis CNCM I-2494
Pathway
Folate biosynthesis
Metabolic pathways
Brite
KEGG Orthology (KO) [BR:bnm00001]
 Metabolism
  Metabolism of cofactors and vitamins
   00790 Folate biosynthesis
    BALAC2494_00624
Enzymes [BR:bnm01000]
 2. Transferases
  2.7  Transferring phosphorus-containing groups
   2.7.6  Diphosphotransferases
    2.7.6.3  2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase
     BALAC2494_00624
 4. Lyases
  4.1  Carbon-carbon lyases
   4.1.2  Aldehyde-lyases
    4.1.2.25  dihydroneopterin aldolase
     BALAC2494_00624
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
594103..595002
Genome map
AA seq 299 aa AA seqDB search
MRTGKRRARNMTTVDCSGIDLGSNEDDMRVWTADVSWVIDDDQLVDAEDLAAHVAAIGQM
MLGVPVEQLAERIAAQLANQSVFRSVTVTVHMHWKAPLRTFEQLSATVTANRQSSANPSA
AAANTGGEESASTHDGALPVDPSYRDAVISLHSAALNAEQLFREVIVTLDSMPGNQVDGI
SPLYFVGSLNGTDGHAAVIKLSTAMGVRQLNQVLDALHTTHEGAVQLSVVATGKVGDESL
HAPKGAADHHLGAAVLEPWAAMDPNASYNGDPLAYLLAMAPDSAQVGVESERWVMGGGR
NT seq 900 nt NT seq  +upstreamnt  +downstreamnt
atgcgaacagggaagaggagggcgaggaatatgacaaccgtggactgcagcggcatcgac
ctgggcagcaacgaggacgacatgcgtgtgtggacggcggacgtcagttgggtcatcgac
gacgaccagctggtggatgccgaggatctggccgcacatgtggcggccatcgggcagatg
atgctcggcgtgcccgtcgaacagcttgccgagcgcatcgcggcgcagctggcgaaccaa
tcggtgttccgctccgtcactgtcaccgtgcacatgcattggaaggccccattgcgcacc
ttcgaacagctcagtgcaacggtcaccgcaaaccggcaatcctcggccaacccatctgct
gccgctgcgaataccgggggcgaggaatctgcaagcacgcatgatggggcattgccggtc
gacccgtcataccgcgatgccgtcatttctttgcatagtgccgcgctgaatgccgagcag
ctgttccgtgaggtcatcgtcacactcgacagtatgccgggcaaccaagtggacggcatc
tccccactgtatttcgtgggctccctcaacgggaccgacggccatgccgccgtgattaaa
ctcagcaccgcaatgggagtgcgtcagctgaatcaggtgctcgatgcgctgcacaccaca
cacgagggagccgtgcagctgtcggttgtggccacaggcaaagtgggggatgaatcactg
catgcaccgaaaggtgcggcggatcatcatctcggcgctgccgtgcttgagccatgggct
gccatggatcccaatgccagctataacggagacccactggcgtatctgctggcaatggcg
cccgacagcgcacaggtgggcgtcgaatccgaacggtgggtcatgggaggcggccgatga

DBGET integrated database retrieval system