KEGG   Bordetella pertussis Tohama I: BP2112Help
Entry
BP2112            gene      T00139                                 

Definition
(RefSeq) BP2112
Organism
bpe  Bordetella pertussis Tohama I
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 2666211
Position
complement(2235354..2236142)
Genome map
NT seq 789 nt NT seq  +upstreamnt  +downstreamnt
acggcaggccgcaccgattgcgcgccggcggccggcaggctggccgggcgggtcgccctg
atcaccggcgcggccggcggcataggcagcgccgccgcgctgcgcttcgcggccgaaggc
gccgcgctggcgctgctggatcggcgccccgacgccatcgagcaactggccggccggatc
tgcggccagggcgggcaggcgataggcgtggccgccgacgtgaccgacgacgacagcgtg
cgccaggccgtacggcgggcagtcgagcatttcggcaggatcgatacgctgttcaactgc
gccggcggatcggtggcgggcgatacggcggtggacaaggtggatctggcgctgtggaac
cgcaccctgcgcctggacctggacggcaccatgctgtgctgccgccacgccgtgccggcg
attgtgcgcgccggcggcggcgcggtcgtcaacatgtcgtccggggccggcctgcgcggc
agcttcggcgggcatgcctacacggccgccaagggcgcggtgattgccctgacccgcgcg
ctggccgccgaatacgcgccgcatggagtgcgggtcaacgccatctgcgcgggccgcatc
cgcaccgaacgcatactgcgcaacctggacgccggcgcaccggcgcaagccggcgcggcg
caacgctatccatgccgcgagggcgacccgatcgacattgcccacatcgcgctgttcctg
gccagccacgagtcgcgcatgatcaccggcgaggccatcgccgccaacggcgggtactcg
gcgttctga

DBGET integrated database retrieval system