KEGG   Bordetella pertussis Tohama I: BP2174Help
Entry
BP2174            CDS       T00139                                 

Definition
(RefSeq) lipoprotein
Organism
bpe  Bordetella pertussis Tohama I
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 2665997
NCBI-ProteinID: NP_880823
UniProt: Q7VWN3
Position
2295279..2295431
Genome map
AA seq 50 aa AA seqDB search
MAGPLVAIIGCVITIYLAMTRYGDQPIAEGAVKRGLVVERVAAPAADARR
NT seq 153 nt NT seq  +upstreamnt  +downstreamnt
atggccgggccgctggtcgccatcatcggctgcgtcatcaccatctacctggcgatgacg
cgctacggcgaccagcccatcgccgagggcgcggtcaagcgcgggctggtggtcgagcgc
gtcgccgcgccggccgccgacgcgcgtcgctga

DBGET integrated database retrieval system