KEGG   Bacillus pumilus SAFR-032: BPUM_03780Help
Entry
BPUM_03780        rRNA      T00599                                 

Definition
(GenBank) 5S ribosomal RNA
Organism
bpu  Bacillus pumilus SAFR-032
SSDB OrthologParalogGene clusterGFIT
Position
37693..37808
Genome map
NT seq 116 nt NT seq  +upstreamnt  +downstreamnt
tttggtggcgatagcgaagaggtcacacccgttcccataccgaacacggaagttaagctc
ttcagcgccgatggtagttgggggtctccccctgtgagagtaggacgccgccaagc

DBGET integrated database retrieval system