KEGG   Bacillus pumilus SAFR-032: BPUM_04400Help
Entry
BPUM_04400        tRNA      T00599                                 

Definition
(GenBank) tRNA-Ala
Organism
bpu  Bacillus pumilus SAFR-032
SSDB OrthologParalogGene clusterGFIT
Position
34527..34602
Genome map
NT seq 76 nt NT seq  +upstreamnt  +downstreamnt
ggggccttagctcagctgggagagcgcctgccttgcacgcaggaggtcagcggttcgatc
ccgctaggctccacca

DBGET integrated database retrieval system