KEGG   Bartonella quintana RM-11: RM11_0737Help
Entry
RM11_0737         tRNA      T02294                                 

Definition
(GenBank) tRNA-Glu
  KO
K14224  
tRNA Glu
Organism
bqr  Bartonella quintana RM-11
Pathway
Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bqr00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    RM11_0737
Non-coding RNAs [BR:bqr03100]
 Transfer RNA
  tRNA
   RM11_0737
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 
Position
925369..925443
Genome map
NT seq 75 nt NT seq  +upstreamnt  +downstreamnt
gcgcccatcgtctagcggttaggacgccgccctttcacggcggaaacaggggttcgattc
cccttgggcgtacca

DBGET integrated database retrieval system