KEGG   Bartonella quintana RM-11: RM11_0824Help
Entry
RM11_0824         CDS       T02294                                 

Definition
(GenBank) Alpha-ketoglutarate permease
Organism
bqr  Bartonella quintana RM-11
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 
NCBI-ProteinID: 
Position
1023798..1024034
Genome map
AA seq 78 aa AA seqDB search
MFPSSVCTLGVSLTHAIGNELFGAPAEYIALKLKKIGHELIFYFYITDVIIIALITLLFV
PDMNKEDIQDDKPLNFTP
NT seq 237 nt NT seq  +upstreamnt  +downstreamnt
atgtttccttcttcagtatgcacactgggagttagtctcactcatgccattggcaatgaa
ttatttggtgctcctgctgaatacatagcccttaaattaaaaaaaattggacatgaactt
atcttttatttttacataacagacgtgataattattgcactcattacactgctctttgta
ccggatatgaataaggaggatatccaagacgataaaccccttaatttcactccatga

DBGET integrated database retrieval system