KEGG   Bacillus subtilis subsp. spizizenii TU-B-10: GYO_0699Help
Entry
GYO_0699          tRNA      T01635                                 

Definition
(GenBank) tRNA-Asn
  KO
K14220  tRNA Asn
Organism
bst  Bacillus subtilis subsp. spizizenii TU-B-10
Pathway
bst00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bst00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    GYO_0699
Non-coding RNAs [BR:bst03100]
 Transfer RNA
  tRNA
   GYO_0699
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
644153..644227
Genome map
NT seq 75 nt NT seq  +upstreamnt  +downstreamnt
tccacagtagctcagtggtagagctatcggctgttaaccgatcggtcgcaggttcgaatc
ctgcctgtggagcca

DBGET integrated database retrieval system