KEGG   Bacillus subtilis subsp. subtilis 168: BSU_misc_RNA_10Help
Entry
BSU_misc_RNA_10   misc_RNA  T00010                                 

Definition
(RefSeq) Purine
Organism
bsu  Bacillus subtilis subsp. subtilis 168
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 
Position
698369..698471
Genome map
NT seq 103 nt NT seq  +upstreamnt  +downstreamnt
catgaaatcaaaacacgacctcatataatcttgggaatatggcccataagtttctacccg
gcaaccgtaaattgccggactatgcaggaaagtgatcgataaa

DBGET integrated database retrieval system