KEGG   Bacillus subtilis subsp. subtilis BAB-1: I653_01910Help
Entry
I653_01910        CDS       T02520                                 

Definition
(GenBank) regulator of the activity of phosphatase RapC
  KO
K06353  
phosphatase RapC regulator
Organism
bsy  Bacillus subtilis subsp. subtilis BAB-1
Pathway
Quorum sensing
Brite
KEGG Orthology (KO) [BR:bsy00001]
 Cellular Processes
  Cellular community - prokaryotes
   02024 Quorum sensing
    I653_01910
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Motif Motif
Other DBs
NCBI-ProteinID: 
Position
421045..421167
Genome map
AA seq 40 aa AA seqDB search
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT
NT seq 123 nt NT seq  +upstreamnt  +downstreamnt
atgaaattgaaatctaagttgtttgttatttgtttggccgcagccgcgatttttacagcg
gctggcgtttctgctaatgcggaagcactcgactttcatgtgacagaaagaggaatgacg
taa

DBGET integrated database retrieval system