KEGG   Bos taurus (cow): 514916Help
Entry
514916            misc_RNA  T01008                                 

Gene name
DYRK2
Definition
uncharacterized DYRK2
Orthology
K18669  
dual specificity tyrosine-phosphorylation-regulated kinase 2/3/4 [EC:2.7.12.1]
Organism
bta  Bos taurus (cow)
Brite
Enzymes [BR:bta01000]
 2. Transferases
  2.7  Transferring phosphorus-containing groups
   2.7.12  Dual-specificity kinases (those acting on Ser/Thr and Tyr residues)
    2.7.12.1  dual-specificity kinase
     514916 (DYRK2)
Protein kinases [BR:bta01001]
 Serine/threonine protein kinases: CMGC group
  DYRK family [OT]
   514916 (DYRK2)
BRITE hierarchy
SSDB OrthologParalogGFIT
Motif Motif
Other DBs
NCBI-GeneID: 
BGD-bta: 
UniProt: 
Position
5
NT seq 3859 nt NT seq  +upstreamnt  +downstreamnt
tttgaaaggaaaatatacccaaggaaaggatggcatattaatgattaagaccaaagtctt
aacagtcagttaatttacataccctttgaaccagaggattccagattactacaaaaggaa
agacatgctctgtgggttcataactgggattgtaaggcaactaggaaaatagtaactgag
aagaggttaataaaactagttctgatattaaaacagaaattctacattcaatgggaaagg
ttttagggggggaaaacttagttttgcttagctttacattgaaataacagtgtaatgaaa
ttttgtcctgagatcccaggggtggtcatcgggtgcctactcatgcaggtaagctcagaa
gggtaagaactgcatgggcaaggagctcgtactgcccagataccatgctggggacttata
gacctcatcacattctaccttcacagtgactctcgaaaagaggttagcagaccctctatg
cagatgttgctaataatagctagaaacattctcaattttaaaaagatacaaagcaaatta
ttccttaattacagatcattttacaaagataaaaaccaatgttagtttaggcatcactgg
catatggaagagtatggaatcttaaaccagaaaacctgtttttaagctctgtgtttgcca
ttatgagttgtataactttaagctaggcatcttattttaagcctcagttcttatctactg
cataaaggagtttattaataaccgaacacccagagctttgcgatgaagtagctagtctgg
tttatttgtgtaatgattcatcacagatacacagaggaagaggcaagaatgggggacgga
tggtaaattgtcagtcctcagaaggaaccctgggtgtatctcacaatattgctcaaggtc
atctcttccccctaaataacttctttactcacccacaccattgtggttctttatccagct
ttaactgtcagatttctataaaactgccataaattacaagatttaaaaatttaaaaggtt
tatatgctcagtatgaaaatctctaaagtacgtgtgtcacatgtataaataatataaaaa
tgactgtatctctggattagctggagggtaacatcaggtaaacacaagcagaacacctag
gaatcaaaaccatacatttcaggagactgagtaacgattccaccgagtatcttgattcct
taccaaataaaaaatggactaaaacagagtttgaaaaagagaggtgttccaagatgatga
ttcagtgaatggcagacactttcctggcatagaacacccactgtttgaggaaatttagaa
gtaatattgagactagctcctcccatcctaaatgttcaaggttaaagctcagatcttctt
cccactcttccctgtgggtaaatggagaagtaagcttttctggaatatttccataatggt
ttctcatgacgagctgttctctatgggagatcaaggtggccacggtgacaccaagttgcc
cccttgaatgcagacctggcaattctaaaaggcagtttagaatgttagcatgtcactaag
caatccccctgtcagcgggggctgcagatctgaggcttaactggggctaaaggatcagct
tccaaactcaccgacagggcagctggctcatgttctactaagtctgttatggactgactc
gaaagaaatctaggaaagggcaggcagctgagacagcaagagcaagaagaaacgacagag
gctccagaagtctggaaaggatatgaactggaggtacaaggacctgcatggttgctgacg
tcctggaatcagcttgtttctggctggtagctcccagtgtggcctggtgatcctgtctcc
tggtgactgactctactagcgagtgctctgtaagttgagccagtggcaggggatgcctgg
cctgggggcctgctgctgggggccctacctagtgatggccctcctatccctctgaagctc
ctggacacactgggcaccactctgctggcacttgtcctggtggcatcaaaggtagaggcc
ccacacagcactctccacatccaggatatagctttctcttttctcttcttacttcttttt
aacattaactctggccttaggatgcagttggaaaaaaagcagatgaaccagccctaagaa
atgctggacaatatgcctagcctttccagacacctagttcacctaggggacaaatgcatc
cccctttcccaggactaaggaaactggctctgtaagtaccctgaccagaacaccaccaac
ctgcttagacacttcagatcaccagctctctagtggtacagacatttcctccagatttcc
ataccagcagtggccacagaggcaaatgcaaacaccagtggccatttggttatgacatcc
atgccccctacacctgaacttcaggccatgtggtcttcatattcttctctagatggttct
ggaccttggtgatggacacagggatgataccatcagtaaatgctacccttctaaggggcg
ttaggcctaactgacaggtctagattatccaaaatgagtcagtttcttaggaattacctt
agttgctttaaaagactgtactttgttttcacatttccatagctagtaaagtttcagatc
attcttaccccaaatgtatcatcagtatccctaaccttatgaacatagcagtactctctc
tccctgccacttccagcttcctctgttctgaattgcttatgcttctcccaaaggacacta
tgttttcttctatttggtgccactgcacatcctattcttctgcctagaatgtcctagcct
ggcttgtctgagtgccaacctcccacatatctttaacatcacagcacttttgaggccagt
caccacttaagctgaagtcatgattccttcccatggaccaccactgtgcctcctgcctgc
cttgatttctgtcccatcacatcattaagtatctcatctcccctactggattgtgattat
taatatccatggccagagccaaagattctttatttaaatgtacagctccagtatcaatag
tgtcaaaaatatgttaggtgcttactgcttattgcttcattgaataacagaatgaggtcc
taacagactgcctgactgaagcctttcccactgcatctgatgattcatcctgtcctctag
gcccagcacatactaaattctttgtaaatgtttctgggataaagatattaagtgagtgaa
taagttttgaaaccagcaatgttcttgtacatttccaattttctctatgatcagcacttt
tcctagtgaagaatcaactcccttctacaagacaccaggctgaattccccaaagtttctt
tctcgctcaccctgcctacctgttatttcaatctggattttgtaaacattcagagcagta
gacatttttacaatgggcaagaaccaaagagcagagtcttactgagtggagcccctgatg
tggttactattaacatcaatacagctctggtctggctatgagttgtgacgattaaatacg
atagtatttgtgaaagggttctatacagagattaatgcagtgtaattttgcaatgtaatt
ttgtaatgatgcattagaataataaggtttgagggtaactcctagaattcacctagttca
ttctccttgaaagctcggatagtgcttttgttcatctttctatatttgccattaacacag
gttggagccatcaataaaaaatagaatgagagaagtccaagcaattgtaaatactaattc
agaggtcagtaagaataagatttttaagtctttgatttgaaaggtatagcatttataatt
aaaatagtgaaagatatta

DBGET integrated database retrieval system