KEGG   Bacillus thuringiensis Bt407: BTB_c44190Help
Entry
BTB_c44190        tRNA      T02277                                 

Gene name
trnM6
Definition
(GenBank) tRNA-Met
  KO
K14230  tRNA Met
Organism
btg  Bacillus thuringiensis Bt407
Pathway
btg00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:btg00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    BTB_c44190 (trnM6)
Non-coding RNAs [BR:btg03100]
 Transfer RNA
  tRNA
   BTB_c44190 (trnM6)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(4283075..4283148)
Genome map
NT seq 74 nt NT seq  +upstreamnt  +downstreamnt
gtggacccttagctcagctggttagagcagacggctcataaccgtccggtcgtaggttcg
agtcctacagggtc

DBGET integrated database retrieval system