KEGG   Bacteroides thetaiotaomicron: BT_3133Help
Entry
BT_3133           CDS       T00122                                 

Definition
alpha-galactosidase
Orthology
K07407  
alpha-galactosidase [EC:3.2.1.22]
Organism
bth  Bacteroides thetaiotaomicron
Pathway
Galactose metabolism
Glycerolipid metabolism
Sphingolipid metabolism
Class
Metabolism; Carbohydrate metabolism; Galactose metabolism [PATH:bth00052]
Metabolism; Lipid metabolism; Glycerolipid metabolism [PATH:bth00561]
Metabolism; Lipid metabolism; Sphingolipid metabolism [PATH:bth00600]
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
complement(3995977..3997950)
Genome map
AA seq 657 aa AA seqDB search
MLLLFLFISNCASGDKIFSTDVWNITYDDQQGGIALTYKSKNICNGMYASYQWEGKEIKT
SDYARHKISTGKVSDSFGKGHIYKVEYTDKELPKLTQYFYLYPGKEYILTDFTVEAKEEI
RSGRMAPVNVDSISGFLQAGDNRALFVPFDNDKWIRYQSHPLGFDTLVSYEVTAIFNNES
RNGLVIGSVEHDNWKTGISIGKGDRDNIGSLVCYGGIADEQTRDVKAHGALAGKKIKSPK
VFLGFFEDWCDGLEAYAKANAVIAPPKAWEKAVPFGWNSWGALQFNLTYEKAMEVSDYFK
ENLQNNHFVNPDQTVYIGLDSGWDCMNEEQLKSFIEKCKSNGQIGGIYWTPFTDWARDPE
RTVDAAPEYKYKDIYLYANGKPQELDGAYAVDPTHPAVEAMMKKTSGLFHRAGFEYVKMD
FMTHGAMEADKWYNPEITTGIQGYNYGMKLLNQYFGDMYINLSISPVFPAQYAQSRRIAC
DAWNQIKDTEYTLNALSYGWWQKYIYQYNDADHIVLRDATDGENRARITSGVITGIYITG
DDFSAGGGKDAKEKSQKYLTNAAVNAVATGEVFRPVEGNGEKSEHIFVRKTPDGRFHCAV
FNYSDQEQTTVLSLERIGLDKARGYQVKELWSGNETFATGQLEVTVPSKDVQLLEFK
NT seq 1974 nt NT seq  +upstreamnt  +downstreamnt
atgcttcttctgtttcttttcatttccaactgtgccagtggagacaagattttctctacc
gatgtatggaatataacttacgatgatcagcaagggggaatagcactcacttataagtca
aaaaatatttgtaacggaatgtatgcttcctatcaatgggaagggaaggagatcaagaca
agtgactatgcccgccataaaatcagtacgggcaaagtttccgattctttcgggaaagga
catatatataaggtggagtatacggataaggagcttccgaagctgactcagtatttctat
ctttatccgggtaaggaatatatactgaccgattttacggtcgaagcgaaagaggaaatc
cgttccggcagaatggctcctgttaatgtcgattctatatccggattcttgcaggcaggt
gataaccgtgctctttttgttccgttcgacaatgacaaatggatcagatatcagtctcac
ccgcttggtttcgatacattggtgagttatgaagtgacagccatattcaataatgaaagc
cggaacggtctggtgatcggctccgtagaacatgataactggaaaacaggtatttcaata
ggtaagggggatcgtgataacattggttcgctggtatgttatgggggcatagcagatgag
cagactcgtgacgtaaaggctcacggtgcattagcaggtaaaaagattaaatcccctaaa
gtctttttgggtttctttgaagattggtgcgatggacttgaagcgtatgcaaaagccaac
gctgtaattgcccctcccaaagcatgggagaaagctgttccatttggttggaacagctgg
ggggcattacaattcaatctgacttatgagaaagcgatggaagtctccgattatttcaag
gagaatctgcagaataatcattttgtaaaccctgatcagactgtctatatcggtctggat
tccggttgggactgtatgaatgaggagcaactgaagtcatttatcgaaaaatgtaagtcg
aacggacagatcggtggtatctactggactccgttcaccgactgggcacgcgatccggaa
cggacggtagatgccgcaccggaatataaatacaaagatatctatctctatgccaacgga
aagccgcaggaactggacggcgcttatgcagtcgatccaacgcatccggcagtggaagct
atgatgaagaagacttccggtttgttccaccgtgcaggattcgagtatgtgaagatggac
ttcatgacacacggtgcgatggaagcggacaaatggtataatcctgagattaccacaggt
atacagggatataattatggcatgaaactgctcaatcaatattttggagatatgtatatc
aatctctccatttctcctgtcttccctgcccagtatgcgcagtcacgcagaatagcctgt
gatgcgtggaatcagatcaaggataccgaatatacattgaacgctctttcatacggctgg
tggcagaagtatatctatcaatataacgatgccgatcatattgtactgagagatgctacc
gacggagaaaaccgtgcccgtattacttcgggtgtcattacgggtatttacattacagga
gacgatttcagtgcgggaggaggaaaagacgccaaagaaaagtcacagaaatatctgacc
aatgcggcagtgaatgcagtagcgacaggagaagtgttccgtcccgtggaaggaaacgga
gagaagtcggaacatatctttgtaaggaagacacccgatggtcgtttccattgtgcggta
ttcaactactcggaccaggaacagacaactgtgctttcgttagaaagaataggattggac
aaggcacgcggctatcaggtgaaagagttgtggagcggcaatgagacttttgccacagga
cagcttgaagtgaccgtaccctccaaagacgtgcaattacttgaatttaaataa

DBGET integrated database retrieval system