KEGG   Burkholderia lata: Bcep18194_B1009Help
Entry
Bcep18194_B1009   CDS       T00286                                 

Definition
pyruvate dehydrogenase (lipoamide) (EC:1.2.4.1)
Orthology
K00163  
pyruvate dehydrogenase E1 component [EC:1.2.4.1]
Organism
bur  Burkholderia lata
Pathway
Glycolysis / Gluconeogenesis
Citrate cycle (TCA cycle)
Pyruvate metabolism
Metabolic pathways
Biosynthesis of secondary metabolites
Microbial metabolism in diverse environments
Carbon metabolism
Module
Pyruvate oxidation, pyruvate => acetyl-CoA
Brite
KEGG Orthology (KO) [BR:bur00001]
 Metabolism
  Overview
   01200 Carbon metabolism
    Bcep18194_B1009
  Carbohydrate metabolism
   00010 Glycolysis / Gluconeogenesis
    Bcep18194_B1009
   00020 Citrate cycle (TCA cycle)
    Bcep18194_B1009
   00620 Pyruvate metabolism
    Bcep18194_B1009
Enzymes [BR:bur01000]
 1. Oxidoreductases
  1.2  Acting on the aldehyde or oxo group of donors
   1.2.4  With a disulfide as acceptor
    1.2.4.1  pyruvate dehydrogenase (acetyl-transferring)
     Bcep18194_B1009
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
JGI: 
UniProt: 
Position
2:complement(1135588..1136706)
Genome map
AA seq 372 aa AA seqDB search
MQTARSGPPVRTPDTRRAAAACLERLLTQRLAPRGRAVSPLGAMRAAADCLERDAATSER
VWIVRADAREPSADTGAHRRISAWPLRFLDARKRFEKPLLYLLHARATDRLRLASVETID
RGIFVNDAETVASSWPKGVTPDVPHWLAANPACTPYDPASGHEAIAILRHALRTLYVAGQ
PGFCYLASHDNLVPDAKPLSATAARDAFSGMVRAGRRAAAGAAAQIRLCGAGSTLAQVME
AADLLHDEWRVDSTIWSCPSYTQLARDGHAADRWNLLHPQDEPQIAHVRRCFGDSRTPVL
AVTGYAGHVAAQIGAFVPARFAVLGADLAGPSPGTRVPGARWIAAVALRLLADDGRVPAD
WAAQAMRRYASG
NT seq 1119 nt NT seq  +upstreamnt  +downstreamnt
atgcagactgcgcgatccggtccgcccgtgcggacacccgacacccgccgcgccgcggcg
gcctgcctcgaaaggctgctgacgcagcggctcgcgccgcgtggccgcgcggtgtcgccg
ctcggtgcgatgcgtgccgccgccgattgtctcgaacgcgatgccgcgacatcggagcgc
gtatggatcgtgcgtgccgatgcgcgggagccgtctgctgacacgggagcccatcgccgc
atcagcgcatggccgctgcggtttctcgatgcgcgcaagcggttcgagaaacccctgctg
tacctgctgcatgcgcgcgcgaccgaccggctgcggctggcgtcggtcgaaaccatcgat
cgcgggatcttcgtcaacgatgccgaaacggtcgcgtcgtcctggccgaaaggcgtgacg
cccgacgtcccgcactggctggccgcgaaccccgcgtgcacgccgtacgatccggcttcg
gggcatgaggcgatcgcgatcctgcgccacgcgctgcgcacgctttatgtcgccggccag
ccgggattctgttacctcgcgagccacgacaacctcgtgcccgatgcgaaaccgctgtcg
gccacggcggcccgcgatgcattcagcggcatggtgcgcgccggccggcgcgcggcagcg
ggcgcggccgcgcagatccggctgtgcggcgcgggcagcacgctcgcgcaggtgatggaa
gcggccgatctgctgcacgacgaatggcgcgtcgattcgacgatctggagctgcccgagc
tacacgcagctcgcccgcgacggtcacgcggccgaccggtggaacctgctgcacccgcag
gacgaaccgcagatcgcgcatgtgcgccgatgcttcggcgacagccgcacaccggtgctc
gcggtgacgggctacgcggggcacgtcgccgcgcagatcggcgcgttcgtaccggcccgc
ttcgcggtgctcggcgcggatctggccggcccgagccccggtacgcgcgtgccgggtgcg
cgctggatcgccgcggtggcgcttcgcctgctggccgacgacggccgcgtgccggccgac
tgggccgcgcaggcaatgcgccgctatgcgagcggctga

DBGET integrated database retrieval system