KEGG   Burkholderia vietnamiensis G4: Bcep1808_4900Help
Entry
Bcep1808_4900     CDS       T00493                                 

Definition
(RefSeq) putative lipoprotein transmembrane
Organism
bvi  Burkholderia vietnamiensis G4
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: 
NCBI-GI: 
NCBI-GeneID: 
JGI: 
UniProt: 
Position
2:1775852..1776727
Genome map
AA seq 291 aa AA seqDB search
MKTSIRLPALLATALVSAALSACGGDGVNPMSAGVAGAASSPAPVAPQPVPPAAQAACRP
AGKFTYTGSASQIAANNGQFAVVTVPTLPPAYANNRNFTAPNAPASSLVQQASGAFTTLA
SSAAATDCLGLDHGAVTEIQSSGTDVAIGRWNQAMDTDGNTYTSTQGVHYAVGTPLALTA
TSGTLACTQLLADTVASDNGGASGTLGATTATLDLGARTLDNLRLSLNVANTAYTLTYAQ
APLNGTSKTGQLSIQSVVVGHDATQPLVAVGYAGSVPNAGGIGGVVVLACK
NT seq 876 nt NT seq  +upstreamnt  +downstreamnt
atgaaaacatccattcgtttgccggccctgttggcaactgcactcgtctcggcggcactg
tctgcgtgtggcggcgacggcgtgaatccgatgagcgccggcgttgccggtgcggcgtcg
tctccggcgcccgtagcgccgcaacctgtgccaccagctgcccaggcggcgtgtcggccg
gccggcaagtttacgtacacgggttccgcgtcgcaaatcgcggcgaataacgggcagttc
gccgtcgtgaccgtgcccacgctgccgcccgcatatgcgaacaaccgcaacttcaccgcg
ccgaatgcgccggcgtcgagtctggttcagcaggcaagcggcgcgttcaccacgctcgcg
tcgtccgctgcggcgaccgactgtctcggtctcgatcacggcgccgtgaccgagatccag
agcagcggcaccgacgttgcgatcggccggtggaaccaggcgatggacaccgacggcaac
acctataccagcacgcaaggcgttcattacgccgtcggtacgccgctggcgttgacggcg
acgagcggtacgctcgcctgcacgcaactgctcgcggatacggtcgcgagcgacaacggc
ggcgcgtccggcacgctcggcgcgactacggctacgctggatctcggcgcacgcacgctc
gacaacctgcgcctgtcgctcaacgtcgcaaacaccgcgtacacgctgacgtacgcacaa
gcaccgttgaacgggacgtcgaaaacggggcagctgtcgattcagtcggtcgtcgtcggc
cacgatgcgacgcagccgctggtcgccgtcggctacgcgggctcggtgccgaatgccggc
ggtatcggcggcgtggtcgtgctggcgtgcaagtga

DBGET integrated database retrieval system