KEGG   Bacteroides vulgatus: BVU_2785Help
Entry
BVU_2785          gene      T00546                                 

Definition
(GenBank) pseudogene
Organism
bvu  Bacteroides vulgatus
SSDB OrthologParalogGene clusterGFIT
Position
complement(3554212..3554709)
Genome map
NT seq 498 nt NT seq  +upstreamnt  +downstreamnt
atgcacatattcaatgcagatggttctgaagtcatgatgtgtggtaacgcctccagatgt
ataggaaagtatgtatatgacaacaaattgactcaaaagaaagccatcacgcaggaaacg
ctctcaggaatcaaggtcctaaaactgcatacggagaacgagctggtagaagaagtaaca
gtggacatggatcttcccctgcttgccaactccagacaaataaataccccggacggcaaa
atgttggcaaaaacaatcacagtagatggaaaagaatacaaaagaacatttgtttgtatg
tgaaatccatatttagtggttttcatagatgatataaaagatgtaaatttgccggcaata
ggtccgaaactggagaatcatccgctttttcccgaacgaaccaatatagaattcgttgaa
gtattatcacataacaagcacaagccattacaagaaaaacaaatacatacgagatataac
aaactcactattatggat

DBGET integrated database retrieval system