KEGG   Candida albicans: CAALFM_C202020WAHelp
Entry
CAALFM_C202020WA  CDS       T00189                                 

Gene name
CaO19.1516
Definition
(RefSeq) ubiquitin-specific protease
Organism
cal  Candida albicans
SSDB OrthologParalogGFIT
Other DBs
NCBI-ProteinID: 
NCBI-GeneID: 
Position
2
AA seq 794 aa AA seqDB search
MTLELPSDIPSTIPANTKIYKDDCMYSFDTPENNLLGLDIDLKTYRAYSRNKDFNYTKQN
YDKTGNYLYLNIKKTLKPQEERNKLLYDDNGEKSPKIQKLEIKNVSDDDYYNTEISIYDI
KDDKSYSRDELSDEFNNLIDLILSANSSATEDEIKQWEQEIVPCPHSIDVEQFETDNLDL
TKCSQCDLRENLWICLHCGALGCGRQQYGSTLKGNGHALAHYELAQHPVAIKLGSLSADS
ESCDAYCYQCNDEVKVPHLAEKLHKFGIDLNTAVKTEKSLIELNIDQNLNWEFKLDGVNG
ERLESVYGKGLTGLQNLGNSCYINSVLQALYTLNGYQEYFKDKKFPDINNPAIDLTSQLI
KLYDGLQSGRYSVPGSLKGDDYQLGIKPSTFKNLIGENHPEFKTQRQQDAFEFLLYFLDK
VDNELGLKLNEELKFLLGTKVVCANCSHGTLSNDLVDNISVPLEAEVIGKDEDGKKAYKE
VELIDSFKKYTTKEDIEGYKCENCHQQPGLAIKSTGFKTFPSTLIVNVQRIQLENWAPVK
VDVPITIPYNLDLSEFKAPVFETGEIESEQIQPESDNNKFVPNEEAMTTLLSMGFPEPRC
IKSLYHTGNSNAEDAMNWIFAHMDDADIDDPFNPNDSHGGASTTTTDDSGPSQDLIDNVA
AMGFSTQLAKKALVLNNNDISAAVEWLFANPDDDGILEDNNQSGPVVNVKQEKSELITRL
NADTQSNGKYELQSVICHKGTSPHTGHYVVFIKKLIDNEYKWVLFNDEKVVVCDDANLQD
IKNNAYVYVFRKVE
NT seq 2385 nt NT seq  +upstreamnt  +downstreamnt
atgacattagaattaccttcggatatcccgctgaccattcctgcaaatactaaaatttac
aaagatgattgcatgtattcttttgatacaccagagaacaatttgttaggattggatatt
gatcttaaaacatatcgggcttattctcgaaacaaggatttcaattacaccaaacaaaat
tatgacaaaacggggaattatttgtatttgaatatcaaaaaaactttaaaaccacaagaa
gaaagaaataaattattgtatgacgataatggtgaaaaatctcccaaaatacagaaattg
gaaatcaaaaatgtatctgatgatgattactacaacactgaaatatccatttatgatatc
aaagatgataaaagttatagtagagatgaattgagtgatgagttcaacaacttgattgat
ttaattctttcagcaaactcttctgccacagaagatgaaattaaacaatgggaacaagaa
attgttccttgtcctcattcaattgacgttgaacaatttgaaactgataatttggatttg
actaaatgtagtcaatgtgatttgcgtgaaaatctttggatatgtttacattgtggtgcc
ttggggtgtggtagacaacaatatggatcgacattgaaaggtaatggacatgctttagct
cattatgagttagctcaacatccagtagcaattaaattgggatcattatcagccgactct
gaaagttgtgatgcatattgttatcaatgtaatgacgaagtcaaagtgccccatttggca
gagaaattacacaagtttggtattgatttaaatactgcagtaaaaaccgagaaatcattg
attgaattaaatatagaccaaaatttgaattgggaatttaaattagatggagttaatggt
gagagattagaatctgtatatggtaagggcttgacgggtttacaaaatttgggcaattct
tgttatataaattcggtactccaagccctttacacattaaacgggtatcaagagtatttc
aaagacaaaaagttccctgatataaataatcctgcaattgatttaacaagtcaattaatc
aaactttacgatgggttacaaagtggcaggtattcagttcctggttcattgaaaggtgat
gattatcaattaggaatcaaaccttctacatttaaaaatttgattggtgaaaaccatcca
gaatttaaaactcaacgacaacaagatgcatttgagtttttgttatattttcttgacaaa
gtggataatgaattgggattgaaacttaatgaggagctaaaattcttacttggtactaaa
gttgtctgtgccaattgttctcatggcactttgtcaaatgatttagtggacaatatttct
gtgccattggaagcagaagtaattgggaaagatgaagatggcaaaaaagcttataaagaa
gttgaattgatcgatagcttcaaaaagtataccaccaaggaagatatcgaaggatacaag
tgtgaaaattgtcatcaacaacctggtttagcaattaaactgacagggttcaagactttc
ccatcaactttaattgtcaatgttcaaagaattcaattagaaaattgggctccagtcaaa
gttgatgtaccaattacaataccatataatttggatctatctgaatttaaagctcctgtg
tttgaaactggggaaattgaatctgaacaaatacaaccagagtcggacaataataagttt
gttcccaatgaagaagcaatgacaaccttattaagtatgggtttcccagaaccaagatgt
attaaaagtttatatcatactggtaatagtaatgccgaggatgctatgaattggattttt
gcccatatggacgatgccgatatagatgatccattcaatccaaatgattctcatggtggt
gcctctactactactactgatgattccggtccttcacaagatttgatagacaatgtagct
gctatgggattttctacacaattggcaaagaaagcgttggtattgaacaataatgatata
agtgctgctgttgaatggttatttgctaatccagacgatgatggaattcttgaagacaac
aaccagagtggtccagttgtcaatgttaagcaagaaaaatcagagttaataacaagatta
aatgcagatactcaatcaaatggtaaatacgagttacaatcagttatatgtcacaagggt
acatccccacatactggtcattatgttgtttttatcaaaaaacttattgataatgaatac
aaatgggtattgtttaatgacgaaaaagttgtggtttgtgatgatgccaatttacaagat
ataaagaataatgcttatgtctatgtatttagaaaggtagagtag

DBGET integrated database retrieval system