KEGG   Candida albicans: CAALFM_C210050WAHelp
Entry
CAALFM_C210050WA  CDS       T00189                                 

Gene name
CaO19.1777
Definition
(RefSeq) ubiquitin-specific protease
Organism
cal  Candida albicans
SSDB OrthologParalogGFIT
Other DBs
NCBI-ProteinID: 
NCBI-GeneID: 
Position
2
AA seq 1383 aa AA seqDB search
MITNNNNNSDNNTSSVDPSINVEELPDSKKQLTEDAIDPTQQQEQQPQLMEIDVETNQII
NENGFENHGVASPEVIDMTGDDDYDVDNHNNNNHNHHNNITIEDDDDNVVDDGDDEEDDD
DDDDDDDDDDDEIQIINSEPNSNVVAPKKFTRNFPLANDFNALAAKLMKPIEDYPTKEET
YYVWEIKDWAQLLKEEKVRSPKFKCGGFEWNILLFPRGNSQNNNLSIYMEPHPPVDENDK
PLDENWYVCAQFGLDIWNPAHPDAHLPNQSHHRFTKNETDWGFSSLIELRQLEQVNNPRN
QSSMYAILENNKLNITGFVRVIDDSSTGVLWHSFLDYDSKANTGYVGLNNQGATCYLNSL
LQSYFTTKLFRKLVYEIPTDSKSAGVPLSLQRIFYLLTNSNDPVGTLELTKSFGWDSSDA
FTQHDVQELNRILMDKLETAMKGSKIEGALNDIFVGKMKSYIKCVNVPYESSRVEDFWDI
QLNVKGFQTLKQSFQNYIEIEMLEGENKYQAGEEHGYQDAKKGVVFESFPPVLHLQLKRF
EYDFMVDDLVKIDDFYEFPDKIDLKPYLDEDLPEDVKNQNWNYKLHGVLVHQGSISNGHY
YAMIKPNANDDTWLRFDDDKVWKVNKTQVFQENFGATDLTQEQSQQMTRAEQQEHMVRRV
TSAYMLVYYRESELDKILPSDDNIVNSAIPEHIPKQIQFEIEEREKLEKARQEALYYTTA
KLITSSTFNANLGFDLALDPTNNKFYDESLSGSACDPISLKVRKDSTFTQLVEAVGKTIK
CTNEKLFRLVAVCHRNNHTNRLDAPIGEEFQKSTISNVYSKIFNRKYDEMVFYVEELNKD
IKNVVQLVKNKDNGYIEPKDFTFEQVFSKIDAVGTDIHPNIEFKNTEEYSNYVTIVIKYF
DPVSQEIRGLSHITVAKEDKIDSIIDPIRELLGFNKNITLELYEELSQSKVEKIDSKLTF
EKHELNSGDIITVQIVNPGEINKNGKFKDLKDYYKFLLTRLHVNVRPFKAEIDEEDSDFI
AHEDDEDEDEENKGGETNNGTGYGGKGNGKDTEKDNKATNDEIQLAKNLSKSFDFWISTN
YSYQDLARDIAVKLNCDPLYLKIFILTAQGQRFPLKTSHHLSQLFPKTVSVNQIVEIEYE
ILNIPLKDYENLKAIKIHWLTTLLQYQVFEVLVPKRGTIGDVITKVLHKVNVSESDLPHL
FVWSGRNHKFHEMLKFDRALSTISDDVDLFCGIFPAEVEVLCDHDMYKRFTDKEIDETKL
EESIHEEYLESIRWSKKLNLLPAFHFHKNNNYHHGIPFIFIVFPAETLNDTKERLRKKLR
LGKQAFDKVRLALADNNNRIKYLEDDSLVLFDEVAIKSYSLAIDNVDRNPKRQALFEKGI
SIK
NT seq 4152 nt NT seq  +upstreamnt  +downstreamnt
atgataacaaataataataacaatagtgataataatactagttcggtggatccatcaata
aatgttgaggagttaccggattccaaaaaacaattgactgaagatgcgattgatcctacg
caacaacaagaacaacaaccccaattaatggaaatagatgttgaaaccaatcaaattata
aatgaaaatggatttgaaaaccatggtgtagccagtcctgaagtgattgatatgacaggt
gatgacgactatgatgttgacaaccacaacaataacaatcacaaccaccacaacaatatc
accattgaagatgatgacgataatgtggttgatgatggtgacgacgaggaagacgacgac
gacgacgacgatgatgatgatgatgatgacgatgaaatacaaataattaattcagaacct
aatagcaatgtcgttgctccaaaaaagtttactcgtaatttcccactagctaatgatttt
aacgctcttgcagccaaactaatgaaacccattgaagactatcccacaaaagaagaaacc
tattatgtttgggaaataaaggattgggcacaacttttaaaggaagaaaaagtccgatca
ccaaaatttaaatgtgggggatttgaatggaatattttattatttcctcgtggtaactca
caaaataataatctatcaatatatatggaacctcatccaccagttgatgaaaatgataaa
ccattagatgaaaattggtatgtttgtgctcaatttggattggatatttggaatccagct
cacccagatgctcatttaccaaatcaaagtcatcatcgatttactaaaaatgaaactgat
tgggggtttagttcattaatagaattgagacaattagaacaagtcaataatccaagaaat
caatcgtcaatgtatgccattttggaaaataataaattaaatatcactgggtttgttcga
gttatagatgattcttctaccggggtattatggcattcatttttagattatgattctaag
gcaaatactggatacgttggtttaaataatcaaggagctacatgttatttgaattcatta
ttacaaagttatttcacaactaaattatttagaaaattagtgtacgaaatccccaccgat
ctgaaatctgcaggagtacctttgtcattacaaagaattttctatttgttgaccaattca
aatgatccggtggggacgttagaattgacaaaatcatttggttgggactcgtcagatgca
ttcacccaacatgatgtacaagaattgaatcgtattttgatggataaattagaaactgct
atgaaagggtcgaaaattgaaggtgcattaaacgatatatttgtggggaaaatgaaatct
tatattaaatgtgtaaatgttccctatgaatcgtcacgggtggaagatttttgggacatt
caattgaatgttaaaggtttccaaactctcaaacaatcatttcaaaattatattgaaatt
gaaatgttggaaggtgaaaataaataccaagcaggtgaagaacatgggtatcaagatgcc
aaaaagggggttgtatttgaatcattcccaccagtattgcatttacaattgaaacgtttc
gaatatgattttatggttgatgatttagttaaaattgatgatttttatgaattccccgat
aaaattgatttgaaaccataccttgatgaagatttaccagaagatgtgaaaaaccaaaat
tggaattataaattgcatggtgtgttggtgcatcaaggtagtatttccaatggtcattat
tatgccatgatcaaaccaaatgctaatgatgatacttggttaagattcgatgacgataaa
gtttggaaagttaataaaactcaagttttccaagagaattttggtgctactgatttgaca
caagaacaatcacaacaaatgacaagagctgaacaacaagaacatatggtgagaagagta
acgtcggcatatatgttggtttattatcgtgaatctgaattagacaaaattttaccaagt
gatgataacattgtcaattctgccattcctgaacatatccccaaacaaattcaatttgaa
attgaggaacgtgaaaaattggaaaaggcaagacaagaagccttgtattatacaactgcc
aaattgataacttcatccacattcaatgccaatcttggatttgatcttgccttggatcca
acgaataataaattttatgatgaatccttgagtggtagtgcatgtgaccctatatcgttg
aaagtaagaaaagatagtacatttactcaattggttgaagcagtgggcaaaacaattaaa
tgtactaatgagaaattatttagattagttgccgtttgtcatagaaataaccataccaat
agattggatgctcccattggtgaagaatttcaaaaatcaacgataagtaatgtttattcg
aaaatatttaatcgaaaatatgatgaaatggttttttatgttgaggaattgaataaagac
attaagaatgttgttcaattggtgaaaaataaggataatggttacattgaacctaaagat
tttacatttgaacaagtgtttagtaaaattgatgctgttggtactgatattcatccgaat
attgaatttaaaaataccgaagagtattctaattatgttactatagttatcaaatatttt
gatcctgtatcacaagaaattagaggattatcacatattactgtggccaaagaagataag
attgattcaattatagacccaatccgtgaattacttggatttaacaaaaatatcacttta
gaattgtatgaagaattatcacaatcaaaagttgaaaagattgattctaaattaactttt
gaaaaacatgaattgaatagtggtgatatcattactgttcaaattgtcaatccaggtgaa
atcaataaaaatggtaaatttaaagatttgaaagactattataaatttttgttaactaga
ttgcatgttaatgtcagaccatttaaggcagaaattgatgaagaagattctgatttcata
gctcatgaagacgatgaagatgaagatgaagaaaataaaggaggtgaaactaacaatggc
actggttatggtggtaagggaaatggaaaagatactgaaaaagataataaagctacaaat
gatgaaattcaattggctaaaaatttgagtaaaagttttgatttttggatttcgacaaat
tatagttatcaagatttagcaagagatattgctgttaaattaaattgtgatcctttatat
ttaaaaatatttatattaactgctcaaggtcaacgattcccattaaagacaagtcatcat
ttatctcaattattccccaagacggtatcagtcaatcaaattgttgaaattgaatatgaa
atacttaatattccattaaaagattatgagaatttgaaagccattaaaatccattggtta
acgacattattacaatatcaagtatttgaagttttagttcctaaacgtggaactataggt
gatgttattactaaagttttacacaaggttaatgtatcggaatcggatttacctcattta
tttgtttggtcaggacgaaatcataaatttcatgagatgcttaaatttgatagggcatta
agtacaatttctgatgatgttgatttattttgtgggattttcccagctgaagttgaagta
ttatgtgatcatgatatgtataaaagatttactgataaagaaattgatgaaacaaaattg
gaagaatcaattcatgaagaatatttagaaagtattagatggagtaaaaaattaaatctt
ttaccagcatttcattttcataaaaataataattatcatcatggaattccatttattttt
atagttttcccggctgaaacgttaaatgatacgaaagaacgattaaggaaaaaattaaga
ttaggaaaacaagcatttgataaagttagacttgcattagctgataataataatagaatc
aaatatttggaagatgattcattggtattgtttgatgaagttgccattaaactgtatagt
ttggctattgataatgttgatagaaatcctaaacgtcaagcattatttgaaaaagggatt
tccatcaaataa

DBGET integrated database retrieval system