KEGG   Candida albicans: CAALFM_C106390WAHelp
Entry
CAALFM_C106390WA  CDS       T00189                                 

Gene name
CaO19.6272
Definition
(RefSeq) ubiquitin-specific protease
Organism
cal  Candida albicans
SSDB OrthologParalogGFIT
Other DBs
NCBI-ProteinID: 
NCBI-GeneID: 
Position
1
AA seq 258 aa AA seqDB search
MTKGDSKRVIPLESNPFLFTELAYQLGLSPILQFHDVYSLTDPDLLAMLPTPIYAIILLF
PLSPNYEKYRQQQDNNNNNNFNSTNLIKYDNNNDIEWFKQTIGNGCGLYALLHILTNLPQ
DLIISNSKLSQLRNNLTKVKEFSIDDRAKIIENLENDIKLDENFGEKGDTKAPDINESVD
LHFISFIKSTKNGHLYELDGRRTGPIDLGESNNKDNNNNNNNIINDPLLIEKIQFYIDNA
DEANKNNFAIMAIGPSFD
NT seq 777 nt NT seq  +upstreamnt  +downstreamnt
atgactaaaggtgattctaaaagagtgattccattagaatcaaatccatttttattcacc
gaattagcttatcaattaggattatcaccaatattacaatttcatgatgtttattcttta
actgatcctgatttattagcaatgttaccaacaccgatatatgccattatattattattc
ccattaagtcccaattatgaaaaatatcgtcaacaacaagataacaacaacaacaacaac
ttcaattctacaaatttgataaaatatgataataataatgatattgaatggtttaaacaa
acaattggtaatggatgtggattatatgctttattacatattttaactaatctacctcaa
gatttaatcatttcaaattctaaattatcacaattaagaaataatttgaccaaagttaag
gaattttctattgatgatcgagcaaaaattattgaaaatttagaaaatgatattaaatta
gatgaaaattttggtgaaaaaggtgatactaaagctcctgatattaatgaatcagttgat
ttacattttatttcatttattaaaagtacgaaaaatggtcatttatatgaattggatggt
agaagaactggtcctattgatttaggtgagtcgaataacaaggacaataataataataat
aataatattattaatgatcctttattgattgaaaaaattcaattttatattgataatgct
gatgaagcaaataaaaataattttgcaattatggctattggtccttcctttgattga

DBGET integrated database retrieval system