KEGG   Cellulophaga algicola: Celal_0079Help
Entry
Celal_0079        gene      T01404                                 

Definition
(GenBank) pseudogene
Organism
cao  Cellulophaga algicola
SSDB OrthologParalogGene clusterGFIT
Position
complement(81780..83354)
Genome map
NT seq 1575 nt NT seq  +upstreamnt  +downstreamnt
atgaatggtaaacgtatgatgtttaagcttgtgttactttgttcggtcttaatttgcaac
agtcagcaccaagaaaaggaatcgataccgcccaatattctttttatagctatagatgat
ctaagaccaactttgggggtctatggcgatactgaagttattactcccaatatagacaaa
ttagcgtctgaaggaatgacttttatggagacctatgcacaagttgcagtttgcgccccc
tctagagctagtctaatgacgggtttacgtccagacgctacacgtgtttggcacttagga
gaggagtttagagtgatcaatcctgaagcagttactatgcctcaatatttttctaaatag
ggctatcataccgttaatttgggtaaaatttttcataattatataccagatgctatatca
tggaagaaccagatttaagaccttctcgatatttaaaaaaagaatggcttaaaagagatg
gagagactttttatagcagcgaagcagttaataaatcacaagtaatcaaaagagattcct
tattaaaattacggccagaacgttacgcagatggttggaatacaggacccgcttgggaag
ctgctgatgtacatgacaccatgtattatgacggagcacaaaccaaactggcaaaacaaa
cgctcacaaggctttctaaatcaaaagtaccattctttttcggattaggatattttagac
cgcatctaccatttgcagcacctaaaaaaatattgggatttatatgatcgtgagaaaatt
tctatggccgtgaatcctaaaattccagaaggagcgctgcttcatagcatgaactctatg
tatgaattaagacattacgatggctttgaacatataggccatcctaccactcctaatcgc
atttctaaagacactattctaaccttaaaacatggttattacgctagtgttagctatgta
gatgcattactgggagacctaattgcacatatgaaaaccattggaatctatgaaaataca
attatcattgtgtttggagatcatggatggaaattaggagaacttaatagttggggtaaa
atgacaaactatactattgatttaaaagtaccaatgatcattaggtatccaaatcagaaa
cttagaggcgtaaagagttatgcgattacagaattaatagatatgtttccctctcttagt
gagctttctgggattcctgttccggaatatatgcagggaactagttttgttcctttatta
gaaaaaccagatttatcatggaaaaaagcaacttttagtcaatttcatagacggcctaag
gggtctgcagatggcaaacgctatatgggatactctataaatacagcgaaatatcattat
attgaatggtatggttgggatgaaaaaacaggtgctaagggcgtttttgtgtcttcagaa
ttgtataactcagaaaatgatgcttttgaaacggttaatctttctaaaaatgaaaactat
actgtagtaattttagacttatcaaaacaacttttagcaggttggaaaaaagcagagcga
gaacctacacgatag

DBGET integrated database retrieval system