KEGG   Clostridium beijerinckii NCIMB 8052: Cbei_0693Help
Entry
Cbei_0693         gene      T00547                                 

Definition
(GenBank) pseudogene
Organism
cbe  Clostridium beijerinckii NCIMB 8052
SSDB OrthologParalogGene clusterGFIT
Position
complement(834190..837089)
Genome map
NT seq 2900 nt NT seq  +upstreamnt  +downstreamnt
atagctgatctatgcaatttagctgggattgcacgatcgtcttactacaaatggattaac
cgttcagagactgaattagataaggaaaattcaataatactaaaagagattgttaagctt
tatgaagatgtaaatggtatctatggataccgtcggataacaatgaatataaatagactt
ctggataaacagtataatcataaacgaatttatagattaatgaaatctattaacatgaga
tcagttataagaaaaaagagaaagcattatattcaaagtactccacaaattacagcagaa
aacaaattaaatagagaattttatgcaaagaaaccaaatgaaaaatggttaacagatgtt
actgaatttaaactacttaatggtaaaaaggcttaccttagcgcaatatttgatttagct
gataagagcattgtttcttatgttgttggtcactcaaataacaatcagcttgtttttgat
acatttgatttagcagtaagtgctaatccgactgcaaagccactgtttcatagtgacaga
ggatttcaggtgcgacaagaagtcgcgtaatacattgtcgttagactgccccatccattc
ggggtaactctatcgtgactagcgtgaatggtaacgtttgggttagaaagctcacgagac
aatgtggaagttcgagtagcctaaactggaacaactgctagagtaagaatgctatggaga
acgtaaagtgaatcattgtaggaatcgttacgctggagaaagcgaaataggctgaaacgc
tttgaccaaaatggtaaggagctgagcaaaggccaactgttaaaccaatgcgaatggata
aagaactcccggtttaaagatgactcctaaggcatttacaattatgtattacgtggaact
tggtaaaccctatatgttccttcagtgagaggtatctaaccgcaaggggcgaaaagacat
agagggcagaagaaaaggataaaaagcgaatgctgattttgtaatggaaacagataaagg
ttcaaaatttgccttaactcgaaagagtgcagacttatcctatggtatttcttagcaaga
aaggattatatatttatgaattttagtaattcaacgacggttaaaaccgagagactaaaa
gacacgaaatcacttgaatttcaatgggaaacaattgactggaagcaagttgaactcgat
gttaatagactacaaacccgaatcgctaaggcaacaaaaaaatggagacaataataaagc
caaaagattacaatacttattaacccactctttttcagctaaggcttatgctgtaagaaa
agtaacaacaaataaaaggaagaatacatctggagtagacaaaaaactatggtatacctc
tgcctcgaagatgaaagctgtgctttcacttactgacaaaaactataaagcaaaaccttt
aaaacgagtatatatcgaaaagaaaggtaagaagcagaaacgtccattaggtataccaac
aatgtatgatagagcaatgcaaacattatatgcattagcgcttgagccaattgcagaaac
aaaaggtgattccatttcctttggattccgccgtggacgaagtgcaaaagatgcctgtga
gcagatattttgtgtattagctagaaaatgttctccaacatggatacttgaaggtgatat
taaaggttgttttgataatattaaccatgaatggttacaaaacaatataccaatggataa
aattattatgaagcagttcctaaaatcaggatatatatatgaagaaaagctgtttccaac
ggaaacaggttcgccacaaggcggtgcaatctcaagtatatatgcaaatatgacattaga
tggactcgaaaaagtgattcaagataaatatcatagaaattcaaaaggtaaaatagaaaa
tcattacagagccaaaactaaagtgaacttgattcggtatgctgatgactttgttattac
tgcaaactcaaaagaaattgctgaagaacttaaaactacggttagtcaattcctccaatc
aagaggtctagcactatcagaagaaaagactgcaattacacatatagataaagggtttga
ctttcttggctggacatttaagaaatacagggggaaattaatagtgaaaccttctaaaaa
ttcaattaaaaacataattaggaaatgttcaacaataatccttaaggagggtaaagctag
cacccaatctgacctaataagaaggcttaatcaagtcgtaagaggttggacaaattacca
caaacatgttgtttttcaaatattaacaacaccctttatcagttactacagcaatgggca
aaacatagacatcccaataagaacaaatggtggagattaaataaatactggcatgaaaaa
ggttggaaaagatggcttttcaagacggattaaaatagtcagacatccaaaattgcaggt
tacaaaaacacctttcttagacaaggactattttgataaaagaaagataaaactgcatat
atttgttgccgcctgaaagggtgaagaaatgcttgagccgtatgagcgggaaactctcac
gtacggttcttagatgagggaaagggagcaatccctttttcttaatcgattatactaata
ggactttcaaagctaaacttgataaaatcaaagcaactcaaagcatgtcacgtgtcagca
gatgtatcgacaacggaccaatggaaggtttttggggaactctaaaatgtgaaatgtact
atttgcaaaaattttatacatatgaagaattgagacaagcgattgatgaatacatagttt
tctataatacaaaaagactacagaaaaacttaaaaggtctgactccaattgaatatcgaa
atcagaccttggtttcataa

DBGET integrated database retrieval system