KEGG   Clostridium botulinum A Hall: CLC_1711Help
Entry
CLC_1711          CDS       T00575                                 

Definition
(RefSeq) hypothetical protein
Organism
cbh  Clostridium botulinum A Hall
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 5399714
NCBI-ProteinID: YP_001387567
UniProt: A5I2P0
Position
1805888..1806043
Genome map
AA seq 51 aa AA seqDB search
MKESTIEKMKKIIEENKRKSSQNNSKLRAKKNIGGSRKAIRNKKTGGLFDK
NT seq 156 nt NT seq  +upstreamnt  +downstreamnt
atgaaggaaagtactatagaaaaaatgaaaaaaataatagaagaaaataagaggaagtct
tcacaaaataattctaagttaagagcaaaaaagaatattggaggaagtagaaaagctatt
agaaataaaaaaactggtggattatttgataaatag

DBGET integrated database retrieval system