KEGG   Corynebacterium diphtheriae NCTC 13129: DIP0590Help
Entry
DIP0590           gene      T00151                                 

Definition
(GenBank) pseudogene
Organism
cdi  Corynebacterium diphtheriae NCTC 13129
SSDB OrthologParalogGene clusterGFIT
Position
join(560297..560683,560741..560950)
Genome map
NT seq 597 nt NT seq  +upstreamnt  +downstreamnt
gtgtcggcactcacaaaaaggaagggaattgtggagaaaaatgcttctgacgttgcgcag
tattctcatgcccagtgcaaacacatcgacattatcggcggaatgaacaaaaaatcaaac
acgtcgatcactatctgtgaagctacttccgctactgccaaacaaggagtagaacaacgt
ggcattgcggtggtcgccgcaggaatgctggcgcccgtcgcaacgctcatccttgtcgcc
gtcaccgacttcattatcaccatgacgctctcggcggccgacgcttccgcgcacatcacg
cactcgaccgaatcccccgtgggtactacctctcaccatcgctttgctcacggctctcgc
ggcagtattttattggggtttttctgagtgatcaccctacttatccccgccgaagctctg
cctgcgggcggccctgccgacgggtgcgccttgtcttacatcgcacacctatatatagga
agcagcttcggcaccatctacgacatcgttactgtcgccatcctgtggttcgtcggcacc
tccgccatgacggggctcctcaacctcatccccaaatacctcccacgctatggatga

DBGET integrated database retrieval system