KEGG   Caenorhabditis elegans (nematode): CELE_T04H1.7Help
Entry
CELE_T04H1.7      CDS       T00019                                 

Gene name
ugt-55
Definition
(RefSeq) UDP-GlucuronosylTransferase
  KO
K00699  glucuronosyltransferase [EC:2.4.1.17]
Organism
cel  Caenorhabditis elegans (nematode)
Pathway
cel00040  Pentose and glucuronate interconversions
cel00053  Ascorbate and aldarate metabolism
cel00830  Retinol metabolism
cel00860  Porphyrin and chlorophyll metabolism
cel00980  Metabolism of xenobiotics by cytochrome P450
cel00982  Drug metabolism - cytochrome P450
cel00983  Drug metabolism - other enzymes
cel01100  Metabolic pathways
Brite
KEGG Orthology (KO) [BR:cel00001]
 Metabolism
  Carbohydrate metabolism
   00040 Pentose and glucuronate interconversions
    CELE_T04H1.7 (ugt-55)
   00053 Ascorbate and aldarate metabolism
    CELE_T04H1.7 (ugt-55)
  Metabolism of cofactors and vitamins
   00830 Retinol metabolism
    CELE_T04H1.7 (ugt-55)
   00860 Porphyrin and chlorophyll metabolism
    CELE_T04H1.7 (ugt-55)
  Xenobiotics biodegradation and metabolism
   00980 Metabolism of xenobiotics by cytochrome P450
    CELE_T04H1.7 (ugt-55)
   00982 Drug metabolism - cytochrome P450
    CELE_T04H1.7 (ugt-55)
   00983 Drug metabolism - other enzymes
    CELE_T04H1.7 (ugt-55)
Enzymes [BR:cel01000]
 2. Transferases
  2.4  Glycosyltransferases
   2.4.1  Hexosyltransferases
    2.4.1.17  glucuronosyltransferase
     CELE_T04H1.7 (ugt-55)
Glycosyltransferases [BR:cel01003]
 Others
  Hydrophobic molecule
   CELE_T04H1.7 (ugt-55)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 188072
NCBI-ProteinID: NP_001335558
WormBase: WBGene00011452
UniProt: A0A1N7SYY6
Position
V:join(12255643..12255829,12256275..12256400,12256666..12256715)
Genome map
AA seq 120 aa AA seqDB search
MSISVYSVTIFTLLTLLPLICISLECINSTSYMDRVLVKPMSSHCRLNNALCVKTMQISQ
NSDGSPKVLSIHRECYELEPPQAYRDGRGCLDSYDEDDPISRRIGPHLITCYCSSDLCNF
NT seq 363 nt NT seq  +upstreamnt  +downstreamnt
atgagtatttccgtatattctgttactattttcacacttttgacattacttccgttaata
tgtatatcactggagtgcatcaactcaacatcatacatggacagagttctcgtcaaacca
atgagctcacattgtcgtttgaataatgcactttgtgtgaagacaatgcaaattagtcag
aattctgatggttcaccaaaggtattatctattcatcgagagtgctatgaacttgaacca
ccacaggcttatagagatggtagaggatgtttggattcatatgatgaagatgatccaatt
tctagacgaattgggccacacttgatcacgtgttactgttcatcggatttatgcaacttc
tga

DBGET integrated database retrieval system