KEGG   Cupriavidus necator N-1: CNE_1c28000Help
Entry
CNE_1c28000       CDS       T01564                                 

Definition
(GenBank) aldose epimerase
Organism
cnc  Cupriavidus necator N-1
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: AEI78114
UniProt: G0ETR5
Position
1:2900456..2900659
Genome map
AA seq 67 aa AA seqDB search
MPGRRIRFELDLPGSAPWHAVTMWSQSASSDFYCVEPWVGLPDAIHHGQGLRWINQGNLK
VRCAGCG
NT seq 204 nt NT seq  +upstreamnt  +downstreamnt
atgccgggtcgccgcatcaggttcgaactcgacctgcccggcagcgcgccctggcatgcc
gtgaccatgtggtcgcagtccgcgagttccgatttctattgcgtggagccgtgggtgggc
ctgcccgatgccatccaccacgggcaggggctgcgctggatcaaccagggcaatctgaaa
gtgcggtgtgccggctgcgggtga

DBGET integrated database retrieval system