KEGG   Cryptococcus neoformans JEC21: CNE03700Help
Entry
CNE03700          CDS       T00243                                 

Definition
glucoamylase S1/s2 precursor (EC:3.2.1.3)
Organism
cne  Cryptococcus neoformans JEC21
Class
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
5:join(1048958..1049836,1049891..1052479,1052532..1052677,1052728..1053526)
Genome map
AA seq 1470 aa AA seqDB search
MGILTRIRRRSSSAAQTQRPSSASPLASHLVPSATSGTATVAPDPPSTGSVGSRIPKRPW
KKKHDEGSSTGSLNKNGKGKTKAENGELLGGPKYGDFSPSLGPASSLSVSNVPTTRVNGP
SSQSSLSPPGNGSPAGDSNSVPCSSEKVEKRRPDVSEIKRPTSRTFKQDGGILGKLNFEV
AGDRQRKTSNSSWTKGVESIVSSGSPSEWPNASMSNANLPSESNPVVTSSSRALTPDLND
DQRPAPTLSRGNKREEDPIEVLESAEKKHRFWKGKGKSNRHSRVMSDSFQLGGSEPPTPG
KIPSSSSGPDLASVSRNSVDLDQPHPQQLRRPSSSFFPNPFYRSLSRASERPSAVEDGSF
QLKSFRHVSGMSDVEGAGKLEGYLSHVKRESVAALSIELPAASTAPDSSLTFASPKPTAV
PLSRPVSVAPSLASMEDMMVSPNRVSVAAFKKGLRRPSNGLMSTMSDIGHGTPATGSGDE
DDDIPLGKRIVSQPLPRQTSSQSLFNMRDPGLSNSEGATSNPMLKQPKKETSEKEVSSQE
PLVFQVKAYRRTSSGFVVKSRSPMASNQDLPSSPVSSLNSLATGFPGSLRPTALTSSAST
RTPSPNAGVTNLYGASPPTTDDKELMTDGYFSAGAPSSDRVVQKGQKPSSPVTYQPTEEL
AKAALPSPPATAQQPSVAPIAELSANVQSSNSHLKRHTPPPVQHIDVPRPSHDISPTLLA
LNLPLPPDQMPDTPPKAPSPLSELPRRPTAGPEGSASPGTQSKRMSLLEEPIKYLSGLWA
TPSAGEDGFDPVLAVDSLGRLSGDEPQSPTKSNRPGITSWYAPQDLPERQTSASPSPFSS
TERIRSSLSERLAGVATSAISTTKPGRGLQKPAMEKLKTSAEEQCPADNHKSPVSDSTVA
PIPRSIPRPFSSFIKPGPVQPNPAIDENESDTEGGTSMSTHHCERLRASSLSSQQSVRRV
PGGPRQPVRQSRIVSMPITNSHLVHKSPDRWRHVQKDDDEDEPLAKIKHRSSKSSLAMAT
AGKSPSYGQISLPTPPTSVTSTSIGSSSPQERRKPLIELESAAPATPQSMTTPRPHDSLL
PASSRSFDKSSTTSTGSTPSSGKESLPSPVRAQVRFDNPERKWPSGFQKKRTSPEISKDN
VNDNAVEVYGERQRRQAEKYSGDSRQRRRSEGALQHPSPYDPPVQAQMGMQEVPDPQDMS
PEAFFAWQKHQWQMQYLAAAYRASEEEWEKQSSVSTSIHNQPSNQFIPFPMQPMSMFPSN
ANMMDMGMGMPMGYGYSAYPQLQGHMFNSYLNMPQMQGQADGEGGCSYGMGAQSVFGGEF
RPLAAKPSQQQQYNPNPQRRASSDQQGAQYGNPPQPHRHQDDPRLAEGRSASALGMYDNA
TSPPTMSKRPSGVFRGLLGEREKVELQQEMERQAQEKLEKQKQWAKERARGKTTESSSPP
PPSSWSRMTGDWSEGGAPRRQNRSRSNIAN
NT seq 4413 nt NT seq  +upstreamnt  +downstreamnt
atgggaattctaacacgtatacgacgaagatcatcctcagcagcacaaacccagcgtcct
tcctctgcttctcctttggcatctcatctcgtaccttcagcgacatccggcactgcgacg
gttgcgcctgatccaccctccaccgggtccgtgggttcacgaataccaaagaggccatgg
aaaaagaagcatgatgaggggagttctacagggagcttgaacaagaacgggaaggggaag
acgaaagcagagaatggtgaactgcttggaggcccgaaatatggagacttttcgccatca
ctagggccagcttcatctctctccgtcagtaacgttccaacgactcgtgtgaatggaccc
tcttctcagtcatctttgtcgccacccggcaatggttctccagctggggacagcaactca
gtgccatgcagtagtgagaaggtcgaaaagcggaggcccgatgtcagcgaaataaagcga
ccgactagccgaactttcaaacaggatggagggatactaggaaagctcaatttcgaggtt
gcgggagatagacagaggaagacgtctaactcgagttggacgaagggcgtagaaagtata
gtgtccagtggttcaccttcagaatggccgaacgcttcgatgtccaatgccaacctcccc
tcagaaagcaatcctgttgtcacatcgagtagcagagcacttacacccgatctaaatgac
gaccagagaccagcgccgacactgtcaagaggtaacaagcgggaagaagaccctatagag
gttctggagtctgcggagaagaaacatcgattctggaagggtaaaggaaagtccaataga
cattcgcgggtcatgagcgactcatttcaactgggcgggtccgagcctcccactccaggc
aaaatcccttcttcgtcaagtgggccggacttggctagcgtctctaggaattctgtagac
ctcgatcagcctcatccacaacaacttcgccgaccttcatcgtcgttcttccccaaccct
ttctatcgatctctatctcgtgcgtcagaaagaccttcggcggtcgaggatggctctttc
cagttgaaaagtttccgccatgtctcgggtatgtctgatgtagagggtgcggggaaacta
gaagggtatctttctcatgtcaaacgggaatcagttgctgctctcagtatcgaactacca
gctgcgtcgacagccccggactcttcactaaccttcgcatctcctaagccgaccgcggtt
cctctgtcacgccctgttagcgtcgctccctcccttgcttcaatggaggatatgatggtt
tctccgaatagagtcagtgttgctgcattcaaaaagggacttcggcgtccaagcaatggt
ctgatgtcgacgatgagtgatatcggacatgggaccccggctactggctctggagacgag
gacgacgacatccctcttggcaagcgaattgtctcgcaacctctgcctagacagacgagc
tctcaatcattgttcaatatgcgcgatcctggtctgagcaattcggaaggtgcgacatct
aatcccatgctcaagcaaccgaaaaaagagacaagtgaaaaggaagtctcaagccaagag
cctttggttttccaggtgaaagcatatcgcagaacgtcaagcggtttcgtggtaaaaagt
cgaagtcccatggcaagtaatcaggacctacctagcagccccgtaagctccctgaactcg
ctggctactggctttcctggatcacttcgcccgacagccttaaccagttccgcatctacc
cggacgccttcaccaaatgcgggagtcaccaacctctatggagcttcacctcccactacg
gacgacaaagagcttatgacagatggatatttttcagcaggtgctccttcttctgatcgg
gttgtgcaaaagggtcagaaaccctcgtctccggtcacttatcaacccaccgaggaactt
gctaaagccgccctcccctcacctcctgccactgcacagcaaccctctgtcgcgcccatt
gcagagctttcggcaaatgtacaatctagtaattcccatctcaaacgacatacaccccct
cctgtccagcatatcgacgtaccacggccttcacacgatatttcacctacgctattagct
cttaatcttccgttgcctccagatcagatgcccgataccccccccaaagcgccttcgcca
ttatcagagctaccgcgtcgacctacagccggaccagaaggaagtgcatctcctggtacc
caaagcaagcggatgtcattattggaagagcccataaagtacctatcagggttatgggct
acaccgtcagctggcgaagatggttttgacccagtgttagctgttgattctttaggtcgg
ttaagtggagatgagcctcagtcgccaactaaatcaaatcgcccaggcatcacctcttgg
tatgcccctcaagacttgcctgaacgccaaacgtcggcctccccgtcaccattttcatcg
acagaacgtatccgttcatctctttcagagagattggctggtgtcgcgacctctgctata
agtacaacaaagcctggccgcggtttacagaaaccagccatggagaaacttaagactagt
gctgaggagcaatgtcctgccgataatcacaagtcaccggtcagcgattctactgtggcc
cctattcctcgatctattcctcgacctttctcaagtttcataaaaccaggaccagttcag
ccaaaccccgcgattgatgagaacgaaagtgataccgaaggggggacgagcatgtccacc
catcactgtgaaagattaagagcgtcctcgctgtcgtctcagcagtctgttagaagagta
cctggtggtccccgacagcccgtgcggcaaagtcgcatcgtctcaatgcctatcacaaat
tctcatttggttcacaaatcacctgatcgttggcgtcatgttcagaaggatgacgatgag
gacgagcctttagcaaagatcaaacatcggtcttccaagtcatctctggccatggctacc
gccggaaaatctccatcctatggacagatttccttgccaacccctcccaccagtgttaca
agtacaagtatcggctcttcgagtcctcaggagcggcgtaagcccctcattgagctggaa
tcagctgcacctgccaccccacagtctatgacgacaccacgaccacatgattccctttta
cctgcatcgtctagatcctttgacaaatcctctacaacatctacaggttctacgccttcg
tccggcaaagaatcgcttccttcccctgtcagggctcaagtcaggtttgataatcctgag
aggaagtggccttctggctttcaaaagaagaggacgagtccagagatatcgaaagataat
gtgaatgacaatgcagtagaagtgtatggagagagacaaaggcgtcaagccgaaaaatat
agtggtgatagtcggcagcgaagacgctcagagggggcgttacaacatccatcgccttat
gaccctcctgttcaggcgcagatgggcatgcaggaggtgccagatccacaagatatgtcc
ccagaagcatttttcgcttggcaaaagcatcaatggcagatgcaataccttgcggccgct
tatcgtgcatctgaagaagagtgggaaaagcaaagttcagtatcaacgtcgattcacaat
cagccttctaaccaattcatccctttccccatgcagcccatgtccatgttcccatccaat
gcgaatatgatggatatgggtatgggtatgccaatgggatatggctattcagcatatccg
caattacaaggacacatgtttaactcttacctcaacatgcctcagatgcaaggccaagcc
gatggagaagggggctgtagttacggaatgggagctcaatcagtatttggtggagaattt
aggccactcgccgccaaaccgtctcaacagcaacagtataatcctaatccccaaagacga
gcatcaagtgatcaacagggtgcccaatatggtaatcctccacaaccccatcgtcatcag
gacgaccctcgtctggcggagggccggagtgcatcagctttgggcatgtacgataatgca
acttctcccccgacaatgtccaaaagaccatcgggcgtgtttagaggactgttaggagag
cgggaaaaggtggaattgcagcaagagatggaacgacaagcgcaggagaagctagagaag
caaaaacagtgggcaaaggagagggcgagagggaagacgactgaaagtagcagcccaccg
cccccgtcaagttggagtagaatgactggtgattggtctgaaggtggcgctccgaggaga
caaaatagaagcagatcgaatatagcgaactaa

DBGET integrated database retrieval system