KEGG   Corynebacterium pseudotuberculosis 1002: Cp1002_2051Help
Entry
Cp1002_2051       CDS       T01876                                 

Definition
(GenBank) Hypothetical protein
Organism
cpk  Corynebacterium pseudotuberculosis 1002
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: 
Position
2268013..2268111
Genome map
AA seq 32 aa AA seqDB search
MELVAAGHKVSTLVGKVFTLSTRNSSGLFGID
NT seq 99 nt NT seq  +upstreamnt  +downstreamnt
atggagctagttgcagcaggtcacaaggtttccactctcgtgggaaaagttttcacatta
tctactagaaatagttcgggactattcggtattgattaa

DBGET integrated database retrieval system