KEGG   Chlamydia pecorum E58: G5S_0194Help
Entry
G5S_0194          tRNA      T01466                                 

Definition
(GenBank) tRNA-Gly
  KO
K14225  
tRNA Gly
Organism
cpm  Chlamydia pecorum E58
Pathway
Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:cpm00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    G5S_0194
Non-coding RNAs [BR:cpm03100]
 Transfer RNA
  tRNA
   G5S_0194
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
202384..202455
Genome map
NT seq 72 nt NT seq  +upstreamnt  +downstreamnt
gcgggtgtagctcagtggtagagcgccacgttgccaacgtgaaggtcgtgagttcaagcc
tcatcacccgct

DBGET integrated database retrieval system