KEGG   Corynebacterium pseudotuberculosis C231: CpC231_0068Help
Entry
CpC231_0068       gene      T01877                                 

Gene name
noxC
Definition
(GenBank) pseudogene
Organism
cpq  Corynebacterium pseudotuberculosis C231
SSDB OrthologParalogGene clusterGFIT
Position
69173..69835
Genome map
NT seq 663 nt NT seq  +upstreamnt  +downstreamnt
ttgcgattgcgtcctgtgggggatactttcgtaccatacctaagaaaattagtgagtgtt
tttaaggagtttcccgtgtcccttactgttgctgaggcaattgcgaatcgccgtgctact
cgtaaatacacagagcaggaggtgagcgacgtggtgcttgatgccgtcgtttcacaagct
cttcaggcaccgagcgcctttaatgcgcagcgtgcagacttggtggtagtctgagatcaa
gcgatcaaagataagatttttgaagcttcggggcaaaagcagcttcgcgacgccccagta
gtcctcatcacagtcgcgcgtgccgacgttcccgaggatctcgatgaagtccttggagcg
gagcgtgcgacgtttgtgcgcaatgttttagctgatgccgatgccgcgcatctacgtgag
acggcgctcaaagacgctatgttggtagcaggctttgcgttgatcgccgctcaaggtgaa
ggcctggccacctcgcccaccacaggttgggatgaggcgaaaattcttgctgctataggc
ttagcggaccgcagtgatcgcgctgtggggttggttatcggtatgggataccctgcggaa
tttccagcgcatcccggtcgagccgagagccgtcgagttgataacggttatgcacgcggc
tga

DBGET integrated database retrieval system