KEGG   Corynebacterium pseudotuberculosis C231: CpC231_0110Help
Entry
CpC231_0110       gene      T01877                                 

Gene name
mntA
Definition
(GenBank) pseudogene
Organism
cpq  Corynebacterium pseudotuberculosis C231
SSDB OrthologParalogGene clusterGFIT
Position
110371..111341
Genome map
NT seq 971 nt NT seq  +upstreamnt  +downstreamnt
atgactaaggaatcatctcgtatcaatcgccatagcaggcgcggttttcttgcggtgtcc
gcactcaccgcagtggccttgctgggcggcctcagcgcatgttctagcgaaaaagctagt
gaaaagccaagtacgctctctgtctttgctaccactggttatatcggcgatgccgtgaag
aatatgcccctgcagctgatgtcactgtgatggtaggccccggcggcgatcctcatactt
atcagcccactacacaggatatttccaagattaagacgtccaatgttgtcctgtggtcgg
gcctgcatatggaagcaaagatgctggatgagctggcagcgcagggagaccgccaggagg
ctgtggctgaagctatcccggaatctgagcggcttgaatggcctgagcttggtgaaaacg
gcgaaaaactttgggatccacacgtgtggaactccacggaaaactggaagtacgttgttg
atgcgattgccaagaagctttcccaggtggataaagaaaacgcggaaacatacaaaaaga
acgctgagacttataaaaagcagattgatcaggccgctgcctatgcaaaggagcagatcg
acgctatccctgcggagaagcgcattctgattaccggacacgatgccttcaattattttg
gtaagcagttcggcctagagattcacgccacagattttgttacctcggagtctgaaatgt
ccccgactgagctggcagacctgggaaaattcatcgcagaaaagaagatacccacgatct
tccaagataatttggccaacccccaggctattaactcgctgaaagagacggtaagggcaa
agggctggaacgtcgaggtctcggataaagagctttacgcggattcgctcggagaaacag
ctcctaccgatacttatattggagttttaaaatacaacgctgatgcgattaaagcggctt
tgaccaagtaa

DBGET integrated database retrieval system