KEGG   Corynebacterium pseudotuberculosis C231: CpC231_0152Help
Entry
CpC231_0152       gene      T01877                                 

Definition
(GenBank) pseudogene
Organism
cpq  Corynebacterium pseudotuberculosis C231
SSDB OrthologParalogGene clusterGFIT
Position
complement(153464..154905)
Genome map
NT seq 1442 nt NT seq  +upstreamnt  +downstreamnt
atgaccctctaccagctttcggaactcaccgaagggttccctgcaccactcgatatccct
gcctctgcagtccaacaagcgatggcagcagataccgtcctcatcgtcctcgatgatgac
cccaccggcacccaatcagtagcaaaccttccagcactgacccgatggaaacaagaagac
ctcgcctgggcgctcagccaaaacaccccagccgtttatgtgatgaccaattcccggtcg
ctcgaccctgatcaagcagctgctatcaatgtctctgtagccgaggcagcctacgccgct
gctcgagatgccgggaagcgccccatcttcgtttctcgtagtgattccacacttcgaggg
catttccctctggagccggatgcgcttgcgggggtcgtcgaaaagcaagaagggccgata
gacggctatattatcgttccggcattcggcgacgcagggcgcatcaccatcgattctgtt
cactatgcgggaaatgccgccacaggttttcagcccgtgggggaaaccgagttcgcccac
gacgccacctttggttattcctcctcacgattgaccgaatgggtcgaagaaaagactcaa
ggagacgtggcagcaactgatgttctttgtattaaattgcgcacaattagatctactagc
aatgatatcgctgcagaacttcttcacgccgcacatcgccaacccatagtcgtggatatc
gttgatgagtatgacctccgcgcccttgctctaggaatcctgcaggcagaacgcatgggg
aagcgttttatctaccgcgtggggccaccctttgtacgcgctcgcatagggcaaaaaccc
ccgaggtgctcagtccagaaacaatcgcagcctcgcgtcatctccccgccaccgtggcgg
gcgggctcatcgtggtcggttcacatgttcctactaccacgcggcaactcaatcacttgc
taaagcactcctctcccagtgtcatcgagttagatgtccgcgccgtgctagcagagaatt
cccaacgctatcttgacagcctccacacccaattagtccaggcgatccggcaaggcaatg
ttgtctttcacacctcacgcgagttggttaccggcgtaagtggtgaggaatcgctgtcca
ttgcacgcaaagtgtcccaagcacttgtcaccgcggtcaatcgcatagtccatgaggtaa
cgccccgctttgtggtggctaaaggcggtatcacctcatcagatgttgcatctcaaggac
tagagatgaccaaagccatggtcattggcccgatgcagccggggatcatctcgctgtggt
ccaccgcagaaggccccgcggcaggcgtgccatacatcgtttttgcaggaaatgtgggca
ccgattcttccctgaccgatgtagtttctgtcctctctcaagattcatccctctcacatt
aa

DBGET integrated database retrieval system