KEGG   Corynebacterium pseudotuberculosis C231: CpC231_t09Help
Entry
CpC231_t09        tRNA      T01877                                 

Definition
(GenBank) tRNA-Ser
  KO
K14233  
tRNA Ser
Organism
cpq  Corynebacterium pseudotuberculosis C231
Pathway
Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:cpq00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    CpC231_t09
Non-coding RNAs [BR:cpq03100]
 Transfer RNA
  tRNA
   CpC231_t09
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
136009..136099
Genome map
NT seq 91 nt NT seq  +upstreamnt  +downstreamnt
ggtagcgtgtccgagcggccgaaggtgctcgcctcgaaagcgagtgttgggtaaccccca
accgcgggttcaaatcccgccgctaccgcca

DBGET integrated database retrieval system