KEGG   Corynebacterium pseudotuberculosis I19: CpI19_2087Help
Entry
CpI19_2087        gene      T01878                                 

Definition
(GenBank) Aldose 1-epimerase; frameshifted
Organism
cpx  Corynebacterium pseudotuberculosis I19
SSDB OrthologParalogGene clusterGFIT
Motif Motif
Position
complement(2295180..2295852)
Genome map
NT seq 673 nt NT seq  +upstreamnt  +downstreamnt
atgacgacaacttttaacatgcccgaagatcgcggccaccttatctctgccagtacctct
gcctgcggtgaaatactctttatgtccagcattccagatatggcgttggggggttccatt
cgtggtggtgtgcccattattgctccgtggtttggcaaacttatggggcacaaggagctg
caacatggatgggcgcgccggcagaaatgggaggtgctagagacctcgggtgggctcgac
gctcgaatgagtcatgatgattgggacttgcgtttggcagtccagtcgacgccgcgaggt
tttgccatgatgctgaaatgtagaaacgcctcaagcgtttgccggaagcttcagttggcg
ttccatccatatttttatgtctctgacgttcttgataccatcgtgaccgcccccggtgag
acctttactacggacggtggtttgttggaggaatttcgcctctccgctcccacgcctctg
cttatcgatgacggccagcgtctcatcaccgttaaagggcaagggactgatcaccgttaa
agggcaagggactgatcactttattgtgtggaaccctggcgagaaactggcgagtgagat
gtccgatatgggcactggggaatggcgaaactttgtctgtgtagagcccgctctcctagg
ggaagactcctaa

DBGET integrated database retrieval system