KEGG   Clostridium stercorarium subsp. stercorarium DSM 8532: Clst_1549Help
Entry
Clst_1549         CDS       T02527                                 

Gene name
ligD1
Definition
LigD (EC:6.5.1.1)
Orthology
K01971  
DNA ligase (ATP) [EC:6.5.1.1]
Organism
csd  Clostridium stercorarium subsp. stercorarium DSM 8532
Pathway
Base excision repair
Nucleotide excision repair
Mismatch repair
Non-homologous end-joining
Class
Genetic Information Processing; Replication and repair; Base excision repair [PATH:csd03410]
Genetic Information Processing; Replication and repair; Nucleotide excision repair [PATH:csd03420]
Genetic Information Processing; Replication and repair; Mismatch repair [PATH:csd03430]
Genetic Information Processing; Replication and repair; Non-homologous end-joining [PATH:csd03450]
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
complement(1731887..1732759)
Genome map
AA seq 290 aa AA seqDB search
MNKSRLQISNPDKLLFPDVGITKLEYIEKLYELSGYILKYTKGRALTTIHYPDGVSEKSY
YQKNIPSHAPDFVSHKLIGDIDYIIMDSAETLLWLGNMAALEFHIPFNSITRPDHPDALV
FDLDPSEGQSFAQVTDAAMIIYNTLEELGIRSYCKTSGATGLQIAVPLAGEIDYDTARKV
NEFFGRYFAQKYPDVFTIERKINDRGKKIYFDYLQMWKGKTIICPYSPRATKTANVSAPV
LWEEVEKGIVPEDFTLKNIIQRLEEKGDLYESVYTSGLDAGIKNLMAEIM
NT seq 873 nt NT seq  +upstreamnt  +downstreamnt
ttgaacaagagcaggttacaaatatccaatccggataaactgctgtttcccgatgtgggg
ataaccaaattggaatatattgaaaaactttatgagttatcgggctatattttaaaatat
acaaaaggcagagcgttgactacaatacattatcctgacggtgtgagcgaaaaatcatat
taccagaaaaacattccttcccatgcgcccgattttgtctcccataaattaataggagat
attgattacattataatggattcggcggaaaccctcctttggcttggaaacatggctgct
ttggaatttcacataccgtttaattcaataaccaggccggaccatcccgatgcccttgtt
tttgatttggatccgtcggaaggtcagtcttttgcccaggtaaccgacgctgcaatgata
atttacaataccctggaagagctgggaattagaagctactgcaagacttcaggggcgact
gggctgcaaatagcggtaccgttggccggtgagattgattacgataccgcaagaaaggta
aatgagtttttcggacggtattttgcacagaaatatcctgatgtttttacaatagagcgt
aaaataaacgacagaggcaaaaaaatatattttgactacctgcagatgtggaagggtaaa
acgattatctgcccgtattcgccgagagctacgaaaactgcgaatgtctcggctcctgtt
ttatgggaagaggtggaaaaaggaattgtacctgaggattttacgttaaaaaacataata
caaaggcttgaggaaaaaggtgatttgtatgaaagtgtatatacctcagggcttgatgca
ggaattaaaaatttaatggcagaaataatgtga

DBGET integrated database retrieval system