KEGG   Cyanothece sp. PCC 8802: Cyan8802_3735Help
Entry
Cyan8802_3735     gene      T00968                                 

Definition
(GenBank) pseudogene
Organism
cyh  Cyanothece sp. PCC 8802
SSDB OrthologParalogGene clusterGFIT
Position
complement(3823517..3824208)
Genome map
NT seq 692 nt NT seq  +upstreamnt  +downstreamnt
atggatgtagaattacaaatcctaaaacatttggctacagatgcccagccaacggtagga
gtcatcgatcaatattgtgagacttataaacatctttttactgaagtaagaagttatgaa
tgttttaagtatttacatttaggaattatctcaccaatcaaaaaaaaatccttaccagaa
atagcgaaagtagtaggaatcaattctcctcaatccctgcatcattttatagctaattcg
ccatagctaattcgccttgggatgtaactgaattaagaaaaacaaggttaaagaagacaa
tgggttgaatatggtttccgtcagtgtaaacaagaactaggttggacagattatcgtttt
actcaatttcccgttattgaaaagtggtgggaaatcattatgagtgcttatttaatggtt
atattagtttaaatactcaaccttttttatctttacaattatctgatagagccaacaaaa
aaactgtcaaccgacccaactcttcttttatacattcacaatggaatgctcagaatggat
ggaagaatattttgaataatcttcgtttagtgattcagccaactcttttattatggttgt
tgtctctttggttagatatttttccaaattcatctttatgcttaggctttcatgatttaa
ttaatgccataaatcagtttcaaccattttag

DBGET integrated database retrieval system