KEGG   Deferribacter desulfuricans: DEFDS_t21Help
Entry
DEFDS_t21         tRNA      T01188                                 

Gene name
trn_Ser4
Definition
tRNA-Ser
Orthology
K14233  
tRNA Ser
Organism
ddf  Deferribacter desulfuricans
Pathway
Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:ddf00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    DEFDS_t21 (trn_Ser4)
Non-coding RNAs [BR:ddf03100]
 Transfer RNA
  tRNA
   DEFDS_t21 (trn_Ser4)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 
Position
complement(1052465..1052555)
Genome map
NT seq 91 nt NT seq  +upstreamnt  +downstreamnt
ggagaggtgtccgagctggccgaaggagcacgattggaaatcgtgtgtaccgccacaagc
ggtaccgagggttcaaatccctccctctccg

DBGET integrated database retrieval system