KEGG   Deferribacter desulfuricans SSM1: DEFDS_t21Help
Entry
DEFDS_t21         tRNA      T01188                                 

Gene name
trn_Ser4
Definition
tRNA-Ser
Orthology
K14233  
tRNA Ser
Organism
ddf  Deferribacter desulfuricans SSM1
Pathway
Aminoacyl-tRNA biosynthesis
Class
Genetic Information Processing; Translation; Aminoacyl-tRNA biosynthesis [PATH:ddf00970]
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 
Position
complement(1052465..1052555)
Genome map
NT seq 91 nt NT seq  +upstreamnt  +downstreamnt
ggagaggtgtccgagctggccgaaggagcacgattggaaatcgtgtgtaccgccacaagc
ggtaccgagggttcaaatccctccctctccg

DBGET integrated database retrieval system