KEGG   Drosophila erecta: Dere_GG16430Help
Entry
Dere_GG16430      CDS       T01060                                 

Definition
(RefSeq) GG16430 gene product from transcript GG16430-RB
Organism
der  Drosophila erecta
SSDB OrthologParalogGFIT
Other DBs
NCBI-ProteinID: 
NCBI-GeneID: 
FlyBase: 
UniProt: 
Position
Unknown
AA seq 556 aa AA seqDB search
MTHYARHDYFHNTQNGALSSDTGRISYSRISYETQTNKEYFSEPYALSNQGPEEYSRGYH
LNSDTVPTTIDKSNNSYDYDYLECYGADIQCDPEEDSVDNWNENTSVAADQYGFEHENLK
CTSSKLLPKLPNNKNVSGSSNACAPQMETKFKKEDAAQRDGCGFGMDQAVAMGSGSSTYE
VYEKIPRPYTSMLPLDYSYYQECCNNTDNLSTYSDTPPSNNAQLKRQNQRKISLMMAMTT
ASVIASGSTISTNAAARDLNRCLAAEPCGVFDSGSVTNFPSTAVTTISKTRKLPKVLPTP
LYKSSRHPITIDTDELNSSLYTSDPLPEKSHRPKQLPKLPKPLSQTKDHSSLDSNWTTLP
VPDALTFDSLEQKSPPSPTTTTTITKEKETISYLSRTASIGARHNNLLYSYDSKEPNKAF
LDKYVEAEPSPSWTPSSPIQSKQSLSPPVSLPSNSCHKVSLTCHLPEIETARSDIESAVN
DLVIEPIPESEKSADPYSGPDSALFNISEYLKPYTLDIINFSGEKKNHITNAASTSTATL
PYNDNGEIISGCNKQK
NT seq 1671 nt NT seq  +upstreamnt  +downstreamnt
atgacccactacgcaaggcatgattactttcataacacccaaaacggtgccttatcctct
gacaccggccgaatatcttatagtcgaatttcttacgaaacacagacgaacaaagaatat
tttagcgagccatatgctttaagcaatcaaggaccagaagaatacagtcgtgggtaccac
ctaaacagtgatacagtacctacaaccatagacaaaagcaacaatagttatgactacgac
tacttagaatgttatggagctgatatccagtgtgatccggaagaggattctgttgacaat
tggaacgaaaacacttcggttgctgcagatcaatatggatttgaacatgaaaatctaaaa
tgtacctcatcgaaattattgcctaagctgccaaataataaaaatgtaagcgggtcatca
aacgcatgtgcccctcagatggaaacaaagtttaaaaaagaagacgcggctcagagggat
ggatgcggcttcggcatggatcaagctgttgcgatgggctctggatctagtacatatgaa
gtttatgaaaaaattccaaggccatacacatccatgttgccgttagattacagttattac
caagaatgttgtaacaataccgacaatctatcaacatacagcgacacaccgccaagcaat
aatgcacaactaaagcggcaaaatcaaaggaagatttcgttaatgatggcgatgactaca
gcttctgtgatagcatctggaagcaccatcagtaccaatgcagctgcaagagacttaaac
agatgtttggcggcggaaccttgtggtgtatttgactctggtagcgtcacaaatttccca
tctactgctgtgacaacaatatcaaagactagaaaattaccaaaggttttaccaacgcca
ctgtacaaatcatctcgtcatccaatcaccatagacaccgatgaattaaattcatcatta
tatacttcagatcctttaccagagaaaagtcatcgcccaaagcagctgcccaagctgcca
aaaccattatcccagaccaaagatcattcaagcctcgattcgaattggacgaccttacct
gtcccagatgcattaacatttgattcgttggaacagaaatcgcccccttctccaacgaca
acaacaacaataacaaaggaaaaagaaaccatctcatacctgtctagaacagcttcaatt
ggtgccaggcataataaccttctttattcctatgatagtaaagaaccaaataaagcattt
ttggacaagtatgtcgaagcagaaccatcgccatcatggaccccatcatcgccaatacaa
tcaaaacaaagtcttagtccacctgtgtcgcttccaagcaatagttgtcataaagtttca
ctaacatgtcacttacctgaaatcgagacagcccgatctgatatagagtcagccgtaaat
gaccttgtcatcgaaccgattccagaaagtgaaaaatcagccgacccatatagcgggccc
gattcagccttatttaacatatctgagtatctaaagccttatacattagatataataaat
ttttccggagaaaaaaaaaatcatatcaccaatgctgccagtacgtcaaccgcaactctt
ccttacaacgataatggggagatcataagtggatgtaacaagcaaaagtag

DBGET integrated database retrieval system