KEGG   Dyadobacter fermentans: Dfer_R0031Help
Entry
Dfer_R0031        tRNA      T00970                                 

Definition
(GenBank) tRNA-Gln
  KO
K14223  
tRNA Gln
Organism
dfe  Dyadobacter fermentans
Pathway
Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:dfe00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    Dfer_R0031
Non-coding RNAs [BR:dfe03100]
 Transfer RNA
  tRNA
   Dfer_R0031
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(4813199..4813269)
Genome map
NT seq 71 nt NT seq  +upstreamnt  +downstreamnt
tggccgatggtgtaatggtaacacaggacattttggttgtcttattcagggttcgagtcc
ttgtcggccaa

DBGET integrated database retrieval system