KEGG   Danio rerio (zebrafish): 450083Help
Entry
450083            CDS       T01004                                 

Gene name
gla, zgc:101584
Definition
galactosidase, alpha (EC:3.2.1.22)
Orthology
K01189  
alpha-galactosidase [EC:3.2.1.22]
Organism
dre  Danio rerio (zebrafish)
Pathway
Galactose metabolism
Glycerolipid metabolism
Sphingolipid metabolism
Glycosphingolipid biosynthesis - globo series
Lysosome
Class
Metabolism; Carbohydrate metabolism; Galactose metabolism [PATH:dre00052]
Metabolism; Lipid metabolism; Glycerolipid metabolism [PATH:dre00561]
Metabolism; Lipid metabolism; Sphingolipid metabolism [PATH:dre00600]
Metabolism; Glycan biosynthesis and metabolism; Glycosphingolipid biosynthesis - globo series [PATH:dre00603]
Cellular Processes; Transport and catabolism; Lysosome [PATH:dre04142]
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
ZFIN: 
Ensembl: 
Vega: 
UniProt: 
Position
14
AA seq 338 aa AA seqDB search
MLDMSLCALMIAGLRNKGTHRGACRQTPKGFPVASKKLADYVHSKGLKLGIYADVGTKTC
AGYPGSLGYYDIDAKTFADWGVDLLKFDGCFMPDWHQLGEGYINMSSALNQTGRSIVYSC
EWPLYEWQHQQPDYEAIRKTCNHWRNYGDVYDQWTSVKSILDWTAEKQKIVVPVAGPGGW
NDPDMLIIGNFGLSRDQQQTQMALWAIMAAPLLMSNDLRDICPKAKELLQNKQIIAINQD
PLGKQGYRILKADSFELWERPLSGNRLAVAVVNRQEIGGPRRFTISVAIMPSWKLCNPKC
NVTQILPTYKEMGVQNLLSEVVVQVNPTGTTLLTVNPL
NT seq 1017 nt NT seq  +upstreamnt  +downstreamnt
atgctggatatgagtttgtgtgcattgatgattgctggccttcgcaacaaagggacgcac
aggggcgcctgcaggcagaccccaaaaggtttcccagtggcatcaaaaaaactggcagat
tatgtccattctaaaggactgaagctgggaatatatgcagatgtgggcacaaaaacttgc
gcaggttaccctgggagtttgggctattatgacatcgatgcaaaaacctttgcggactgg
ggtgtggatctgttaaaatttgacgggtgtttcatgcctgactggcatcagctgggagaa
ggttatataaatatgtcaagtgcactaaaccagactggcagaagtattgtttactcttgt
gaatggccgttatatgagtggcagcaccaacagcctgactatgaggcaattcgcaagacc
tgtaaccactggcgtaattatggagatgtgtatgaccagtggaccagtgtgaagagcatc
ctggactggacagcagaaaagcagaagatcgtcgtcccagtggcaggaccagggggatgg
aatgaccctgacatgctgatcattggaaacttcggcttgagtcgcgatcagcagcagact
cagatggcattgtgggcaatcatggcggctccacttctaatgtctaacgacctgcgagac
atctgtcccaaagccaaagaactactgcagaacaagcagatcatcgccatcaaccaggac
cctctgggcaaacagggctatcggatattgaaggctgacagttttgagctgtgggaaagg
cccttgtcaggcaacaggctggccgtggcagtggtgaacagacaggagattggaggtccg
cgcagatttactatttcagtggcaataatgcctagctggaagctttgtaacccgaaatgc
aacgtaacccagatcctgcccacttacaaggaaatgggcgtccaaaatctcttgtcagag
gtggtggtccaagtcaaccctacaggcacaacactactcaccgtcaacccactgtga

DBGET integrated database retrieval system