KEGG   Dinoroseobacter shibae: Dshi_0475Help
Entry
Dshi_0475         CDS       T00612                                 

Gene name
cytC
Definition
(GenBank) cytochrome c class I
  KO
K08738  cytochrome c
Organism
dsh  Dinoroseobacter shibae
Pathway
dsh02020  Two-component system
Brite
KEGG Orthology (KO) [BR:dsh00001]
 Environmental Information Processing
  Signal transduction
   02020 Two-component system
    Dshi_0475 (cytC)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: ABV92223
RoseoBase: Dshi_0475
UniProt: A8LNR5
Position
460328..460729
Genome map
AA seq 133 aa AA seqDB search
MNRILAAATCLVTLPVLAMAAGDITVDAAAGEKVFRTGKAYHQVSVDAESRASPRLNGAV
DRAVGSIEGFSYSDAFVVLNAEGTIRSTEKFAAFLAKPKNFEKGTMIAFAGLRKKEDRKN
MIAYLATCWVEGM
NT seq 402 nt NT seq  +upstreamnt  +downstreamnt
atgaaccgcatcctcgccgcagcgacttgtctcgtgacactgcctgtcttggctatggcg
gctggcgatatcaccgtagacgctgccgccggcgagaaggttttccgtaccggcaaggcg
tatcaccaagtaagcgtcgatgccgaaagcagagccagtccccggctcaacggtgcggtc
gaccgcgcagtcggttcgatcgaggggttctcgtattccgacgcgtttgtggttctgaat
gccgaaggcacaatcaggagcacagaaaaatttgcggcgtttcttgccaaacccaagaac
ttcgaaaaaggcacaatgatagcctttgcgggtcttcggaagaaagaggaccgcaagaac
atgattgcctatctcgccacctgctgggtggaagggatgtaa

DBGET integrated database retrieval system